Mutagenetix > Incidental Mutations

Incidental Mutation 'R7666:Muc16'

591935

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R7666 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18558427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 7284 (Y7284C)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000208663
AA Change: Y7284C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh4a1	G	A	4: 139,633,957	V72M	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atl3	T	C	19: 7,510,040	S107P	probably benign	Het
Brpf3	T	C	17: 28,810,572	L502P	possibly damaging	Het
C6	T	A	15: 4,789,505	S440T	probably damaging	Het
Car3	A	G	3: 14,870,064	H177R	probably benign	Het
Ccdc148	A	G	2: 58,934,500	W310R	probably damaging	Het
Cchcr1	C	T	17: 35,526,486	T401I	probably benign	Het
Cdk13	G	A	13: 17,772,576		probably benign	Het
Celsr2	A	G	3: 108,398,588	S2067P	probably benign	Het
Chrng	A	T	1: 87,209,453	T278S	probably benign	Het
Clec14a	T	A	12: 58,267,757	T360S	probably benign	Het
Cr2	A	G	1: 195,154,225	Y877H	probably damaging	Het
Crybg3	A	T	16: 59,559,337	L518*	probably null	Het
Cyp2c38	A	T	19: 39,438,242	V205D	possibly damaging	Het
Dlg5	G	A	14: 24,157,799	P1113L	probably damaging	Het
Dnah7a	A	T	1: 53,547,297	V1465E	probably benign	Het
Fbn1	C	T	2: 125,306,471	C2619Y	probably damaging	Het
Fbxl4	A	G	4: 22,376,869	T102A	probably benign	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Gimap8	A	C	6: 48,659,155	N618T	probably damaging	Het
Gk5	T	A	9: 96,153,107	F286L	probably damaging	Het
Gm13078	A	T	4: 143,728,515	Y461F	probably benign	Het
Gucy2c	G	A	6: 136,697,968	S1039L	probably benign	Het
Hmcn2	C	T	2: 31,380,233	P1161S	probably damaging	Het
Hnrnpa2b1	A	T	6: 51,466,937	V78E	possibly damaging	Het
Ick	G	C	9: 78,167,620	V586L	probably benign	Het
Ltbp3	C	T	19: 5,747,006	S387L	possibly damaging	Het
Mrpl48	A	G	7: 100,565,201	V64A	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Myh4	A	T	11: 67,256,281	D1584V	probably damaging	Het
Myl7	A	G	11: 5,897,140	F138L	possibly damaging	Het
Nek5	T	C	8: 22,090,517	K395R	probably benign	Het
Olfr1328	T	A	4: 118,934,264	T195S	probably damaging	Het
Olfr1448	A	G	19: 12,920,162	L49P	probably damaging	Het
Olfr720	A	T	14: 14,176,075	D2E	probably benign	Het
Phf7	C	T	14: 31,240,354	E165K	probably damaging	Het
Pnpla6	A	G	8: 3,541,591	Y1213C	probably benign	Het
Ppp1r9a	A	T	6: 5,143,238	K1005N	probably benign	Het
Ppp2r3d	A	T	9: 124,440,873	D8E	probably damaging	Het
Ptprn2	C	A	12: 116,841,320	R152S	probably benign	Het
Smc5	A	T	19: 23,229,017	D724E	probably benign	Het
Snx30	T	C	4: 59,885,047	V229A	probably benign	Het
Spata31d1c	A	C	13: 65,036,000	N452T	probably benign	Het
Tacc2	C	T	7: 130,716,814		probably benign	Het
Thsd7a	C	T	6: 12,379,438	D996N		Het
Tubb2b	A	G	13: 34,128,135	L225P	probably damaging	Het
Ubr4	A	G	4: 139,413,480	T1237A	possibly damaging	Het
Unc50	G	A	1: 37,431,415	R40Q	possibly damaging	Het
Usp31	T	C	7: 121,649,181	E1013G	possibly damaging	Het
Vwa5a	A	G	9: 38,733,963	D448G	probably benign	Het
Wnt5a	T	C	14: 28,518,372	S160P	possibly damaging	Het
Zfp618	T	A	4: 63,132,717	Y578*	probably null	Het
Zfp804a	C	T	2: 82,259,060	Q1078*	probably null	Het
Zfp808	C	T	13: 62,171,411	T131M	probably benign	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R7038_muc16_859	UTSW	9	18620468	missense	probably damaging	0.99
Runneymeade	UTSW	9	18579317	critical splice donor site	probably null
slimey	UTSW	9	18590698	missense	probably damaging	1.00
viscous	UTSW	9	18644732	missense	unknown
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8351:Muc16	UTSW	9	18659885	missense	unknown
R8356:Muc16	UTSW	9	18658778	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8463:Muc16	UTSW	9	18659139	missense	unknown
R8466:Muc16	UTSW	9	18643148	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
R8556:Muc16	UTSW	9	18640937	missense	probably benign	0.01
R8679:Muc16	UTSW	9	18646448	missense	unknown
R8680:Muc16	UTSW	9	18644719	missense	unknown
R8720:Muc16	UTSW	9	18641600	missense	probably benign	0.01
R8729:Muc16	UTSW	9	18660050	missense	unknown
R8736:Muc16	UTSW	9	18550843	nonsense	probably null
R8739:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R8807:Muc16	UTSW	9	18656057	missense	unknown
R8830:Muc16	UTSW	9	18646069	missense	unknown
R8871:Muc16	UTSW	9	18656048	missense	unknown
R8884:Muc16	UTSW	9	18644200	missense	unknown
R8923:Muc16	UTSW	9	18638676	missense	probably benign	0.01
R8948:Muc16	UTSW	9	18647233	missense	unknown
R8949:Muc16	UTSW	9	18520925	critical splice donor site	probably null
R8987:Muc16	UTSW	9	18551685	nonsense	probably null
R8997:Muc16	UTSW	9	18607467	intron	probably benign
R9013:Muc16	UTSW	9	18512773	missense	possibly damaging	0.94
R9020:Muc16	UTSW	9	18638719	small insertion	probably benign
R9036:Muc16	UTSW	9	18644679	missense	unknown
R9040:Muc16	UTSW	9	18644786	nonsense	probably null
R9065:Muc16	UTSW	9	18643009	missense	unknown
R9089:Muc16	UTSW	9	18644550	missense	unknown
R9098:Muc16	UTSW	9	18643679	missense	unknown
R9100:Muc16	UTSW	9	18645670	missense	unknown
R9128:Muc16	UTSW	9	18647582	missense	unknown
R9169:Muc16	UTSW	9	18656528	missense	unknown
R9180:Muc16	UTSW	9	18642742	missense	unknown
R9191:Muc16	UTSW	9	18644810	missense	unknown
R9203:Muc16	UTSW	9	18551688	missense	unknown
R9208:Muc16	UTSW	9	18508537	missense	probably damaging	0.99
R9232:Muc16	UTSW	9	18656040	missense	unknown
R9240:Muc16	UTSW	9	18538013	missense	unknown
R9254:Muc16	UTSW	9	18646171	missense	unknown
R9330:Muc16	UTSW	9	18641036	missense	probably benign	0.04
R9347:Muc16	UTSW	9	18660215	missense	unknown
R9358:Muc16	UTSW	9	18642224	missense	probably benign	0.01
R9359:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9379:Muc16	UTSW	9	18646171	missense	unknown
R9403:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9422:Muc16	UTSW	9	18641806	missense	probably benign	0.01
R9433:Muc16	UTSW	9	18572641	missense	probably benign	0.09
R9438:Muc16	UTSW	9	18647732	missense	unknown
R9442:Muc16	UTSW	9	18655328	missense	unknown
R9453:Muc16	UTSW	9	18660765	missense	unknown
R9467:Muc16	UTSW	9	18597035	missense	probably benign	0.03
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTCTGAAACAAAGGGCCG -3'
(R):5'- TCACTAACCCAGCTTGAGCAG -3'

Sequencing Primer
(F):5'- CTGAAACAAAGGGCCGAGCTATAAG -3'
(R):5'- CTAACCCAGCTTGAGCAGATAATGTG -3'

Posted On

2019-11-12