Mutagenetix > Incidental Mutations

Incidental Mutation 'R7666:Muc16'

591935

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R7666 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18558427 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 7284 (Y7284C)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208663
AA Change: Y7284C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh4a1	G	A	4: 139,633,957	V72M	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atl3	T	C	19: 7,510,040	S107P	probably benign	Het
Brpf3	T	C	17: 28,810,572	L502P	possibly damaging	Het
C6	T	A	15: 4,789,505	S440T	probably damaging	Het
Car3	A	G	3: 14,870,064	H177R	probably benign	Het
Ccdc148	A	G	2: 58,934,500	W310R	probably damaging	Het
Cchcr1	C	T	17: 35,526,486	T401I	probably benign	Het
Cdk13	G	A	13: 17,772,576		probably benign	Het
Celsr2	A	G	3: 108,398,588	S2067P	probably benign	Het
Chrng	A	T	1: 87,209,453	T278S	probably benign	Het
Clec14a	T	A	12: 58,267,757	T360S	probably benign	Het
Cr2	A	G	1: 195,154,225	Y877H	probably damaging	Het
Crybg3	A	T	16: 59,559,337	L518*	probably null	Het
Cyp2c38	A	T	19: 39,438,242	V205D	possibly damaging	Het
Dlg5	G	A	14: 24,157,799	P1113L	probably damaging	Het
Dnah7a	A	T	1: 53,547,297	V1465E	probably benign	Het
Fbn1	C	T	2: 125,306,471	C2619Y	probably damaging	Het
Fbxl4	A	G	4: 22,376,869	T102A	probably benign	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Gimap8	A	C	6: 48,659,155	N618T	probably damaging	Het
Gk5	T	A	9: 96,153,107	F286L	probably damaging	Het
Gm13078	A	T	4: 143,728,515	Y461F	probably benign	Het
Gucy2c	G	A	6: 136,697,968	S1039L	probably benign	Het
Hmcn2	C	T	2: 31,380,233	P1161S	probably damaging	Het
Hnrnpa2b1	A	T	6: 51,466,937	V78E	possibly damaging	Het
Ick	G	C	9: 78,167,620	V586L	probably benign	Het
Ltbp3	C	T	19: 5,747,006	S387L	possibly damaging	Het
Mrpl48	A	G	7: 100,565,201	V64A	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Myh4	A	T	11: 67,256,281	D1584V	probably damaging	Het
Myl7	A	G	11: 5,897,140	F138L	possibly damaging	Het
Nek5	T	C	8: 22,090,517	K395R	probably benign	Het
Olfr1328	T	A	4: 118,934,264	T195S	probably damaging	Het
Olfr1448	A	G	19: 12,920,162	L49P	probably damaging	Het
Olfr720	A	T	14: 14,176,075	D2E	probably benign	Het
Phf7	C	T	14: 31,240,354	E165K	probably damaging	Het
Pnpla6	A	G	8: 3,541,591	Y1213C	probably benign	Het
Ppp1r9a	A	T	6: 5,143,238	K1005N	probably benign	Het
Ppp2r3d	A	T	9: 124,440,873	D8E	probably damaging	Het
Ptprn2	C	A	12: 116,841,320	R152S	probably benign	Het
Smc5	A	T	19: 23,229,017	D724E	probably benign	Het
Snx30	T	C	4: 59,885,047	V229A	probably benign	Het
Spata31d1c	A	C	13: 65,036,000	N452T	probably benign	Het
Tacc2	C	T	7: 130,716,814		probably benign	Het
Thsd7a	C	T	6: 12,379,438	D996N		Het
Tubb2b	A	G	13: 34,128,135	L225P	probably damaging	Het
Ubr4	A	G	4: 139,413,480	T1237A	possibly damaging	Het
Unc50	G	A	1: 37,431,415	R40Q	possibly damaging	Het
Usp31	T	C	7: 121,649,181	E1013G	possibly damaging	Het
Vwa5a	A	G	9: 38,733,963	D448G	probably benign	Het
Wnt5a	T	C	14: 28,518,372	S160P	possibly damaging	Het
Zfp618	T	A	4: 63,132,717	Y578*	probably null	Het
Zfp804a	C	T	2: 82,259,060	Q1078*	probably null	Het
Zfp808	C	T	13: 62,171,411	T131M	probably benign	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TCCTCTGAAACAAAGGGCCG -3'
(R):5'- TCACTAACCCAGCTTGAGCAG -3'

Sequencing Primer
(F):5'- CTGAAACAAAGGGCCGAGCTATAAG -3'
(R):5'- CTAACCCAGCTTGAGCAGATAATGTG -3'

Posted On

2019-11-12