Incidental Mutation 'R7666:Ick'
ID591937
Institutional Source Beutler Lab
Gene Symbol Ick
Ensembl Gene ENSMUSG00000009828
Gene Nameintestinal cell kinase
Synonyms2210420N10Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001163780, NM_019987

Is this an essential gene? Possibly essential (E-score: 0.744) question?
Stock #R7666 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78109192-78172107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 78167620 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 586 (V586L)
Ref Sequence ENSEMBL: ENSMUSP00000048234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044551] [ENSMUST00000117330] [ENSMUST00000118869]
Predicted Effect probably benign
Transcript: ENSMUST00000044551
AA Change: V586L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048234
Gene: ENSMUSG00000009828
AA Change: V586L

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117330
SMART Domains Protein: ENSMUSP00000113655
Gene: ENSMUSG00000009828

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118869
AA Change: V586L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112961
Gene: ENSMUSG00000009828
AA Change: V586L

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal primary cilium morphology and Shh signaling during limb digit patterning, peripheral edema, cleft palate, hydrocephalus, polydactyly, delayed skeletal development, and embryonic lethality at late stages of gestation. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted, other(1) Gene trapped(28)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 G A 4: 139,633,957 V72M probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atl3 T C 19: 7,510,040 S107P probably benign Het
Brpf3 T C 17: 28,810,572 L502P possibly damaging Het
C6 T A 15: 4,789,505 S440T probably damaging Het
Car3 A G 3: 14,870,064 H177R probably benign Het
Ccdc148 A G 2: 58,934,500 W310R probably damaging Het
Cchcr1 C T 17: 35,526,486 T401I probably benign Het
Cdk13 G A 13: 17,772,576 probably benign Het
Celsr2 A G 3: 108,398,588 S2067P probably benign Het
Chrng A T 1: 87,209,453 T278S probably benign Het
Clec14a T A 12: 58,267,757 T360S probably benign Het
Cr2 A G 1: 195,154,225 Y877H probably damaging Het
Crybg3 A T 16: 59,559,337 L518* probably null Het
Cyp2c38 A T 19: 39,438,242 V205D possibly damaging Het
Dlg5 G A 14: 24,157,799 P1113L probably damaging Het
Dnah7a A T 1: 53,547,297 V1465E probably benign Het
Fbn1 C T 2: 125,306,471 C2619Y probably damaging Het
Fbxl4 A G 4: 22,376,869 T102A probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gimap8 A C 6: 48,659,155 N618T probably damaging Het
Gk5 T A 9: 96,153,107 F286L probably damaging Het
Gm13078 A T 4: 143,728,515 Y461F probably benign Het
Gucy2c G A 6: 136,697,968 S1039L probably benign Het
Hmcn2 C T 2: 31,380,233 P1161S probably damaging Het
Hnrnpa2b1 A T 6: 51,466,937 V78E possibly damaging Het
Ltbp3 C T 19: 5,747,006 S387L possibly damaging Het
Mrpl48 A G 7: 100,565,201 V64A probably benign Het
Muc16 T C 9: 18,558,427 Y7284C probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myh4 A T 11: 67,256,281 D1584V probably damaging Het
Myl7 A G 11: 5,897,140 F138L possibly damaging Het
Nek5 T C 8: 22,090,517 K395R probably benign Het
Olfr1328 T A 4: 118,934,264 T195S probably damaging Het
Olfr1448 A G 19: 12,920,162 L49P probably damaging Het
Olfr720 A T 14: 14,176,075 D2E probably benign Het
Phf7 C T 14: 31,240,354 E165K probably damaging Het
Pnpla6 A G 8: 3,541,591 Y1213C probably benign Het
Ppp1r9a A T 6: 5,143,238 K1005N probably benign Het
Ppp2r3d A T 9: 124,440,873 D8E probably damaging Het
Ptprn2 C A 12: 116,841,320 R152S probably benign Het
Smc5 A T 19: 23,229,017 D724E probably benign Het
Snx30 T C 4: 59,885,047 V229A probably benign Het
Spata31d1c A C 13: 65,036,000 N452T probably benign Het
Tacc2 C T 7: 130,716,814 probably benign Het
Thsd7a C T 6: 12,379,438 D996N Het
Tubb2b A G 13: 34,128,135 L225P probably damaging Het
Ubr4 A G 4: 139,413,480 T1237A possibly damaging Het
Unc50 G A 1: 37,431,415 R40Q possibly damaging Het
Usp31 T C 7: 121,649,181 E1013G possibly damaging Het
Vwa5a A G 9: 38,733,963 D448G probably benign Het
Wnt5a T C 14: 28,518,372 S160P possibly damaging Het
Zfp618 T A 4: 63,132,717 Y578* probably null Het
Zfp804a C T 2: 82,259,060 Q1078* probably null Het
Zfp808 C T 13: 62,171,411 T131M probably benign Het
Other mutations in Ick
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ick APN 9 78164539 missense probably benign 0.00
IGL01679:Ick APN 9 78140025 missense possibly damaging 0.94
IGL02525:Ick APN 9 78160393 missense probably benign 0.37
IGL02719:Ick APN 9 78140019 missense probably damaging 0.99
H8930:Ick UTSW 9 78150619 missense possibly damaging 0.92
R0471:Ick UTSW 9 78155517 critical splice donor site probably null
R1626:Ick UTSW 9 78150637 missense probably damaging 1.00
R1824:Ick UTSW 9 78157862 missense probably benign
R2186:Ick UTSW 9 78131487 missense probably benign 0.07
R2872:Ick UTSW 9 78140100 splice site probably null
R2872:Ick UTSW 9 78140100 splice site probably null
R4609:Ick UTSW 9 78167789 utr 3 prime probably benign
R4737:Ick UTSW 9 78150654 missense probably damaging 1.00
R4792:Ick UTSW 9 78153693 missense probably damaging 1.00
R5001:Ick UTSW 9 78131519 missense probably damaging 1.00
R5060:Ick UTSW 9 78153696 missense probably benign 0.01
R5093:Ick UTSW 9 78140021 missense probably benign 0.24
R5393:Ick UTSW 9 78160715 missense probably benign
R6199:Ick UTSW 9 78164639 missense probably benign 0.04
R6412:Ick UTSW 9 78139976 missense probably damaging 1.00
R7038:Ick UTSW 9 78109202 unclassified probably benign
R7468:Ick UTSW 9 78157939 missense probably benign 0.00
R7660:Ick UTSW 9 78167620 missense probably benign
R7661:Ick UTSW 9 78167620 missense probably benign
R7662:Ick UTSW 9 78167620 missense probably benign
R7693:Ick UTSW 9 78157726 missense probably benign
R7783:Ick UTSW 9 78135645 missense probably damaging 0.97
R7787:Ick UTSW 9 78167620 missense probably benign
R7788:Ick UTSW 9 78167620 missense probably benign
X0067:Ick UTSW 9 78155403 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAGATGATAGAGTCTTCCC -3'
(R):5'- GGGTTGTTTTACACCGCCTC -3'

Sequencing Primer
(F):5'- GATGATAGAGTCTTCCCACAGATTTC -3'
(R):5'- TACACCGCCTCGTGGTTGTG -3'
Posted On2019-11-12