Incidental Mutation 'R7666:Phf7'
ID591952
Institutional Source Beutler Lab
Gene Symbol Phf7
Ensembl Gene ENSMUSG00000021902
Gene NamePHD finger protein 7
Synonyms1700010P14Rik, 1700006H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7666 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31237689-31251317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31240354 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 165 (E165K)
Ref Sequence ENSEMBL: ENSMUSP00000022459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022459] [ENSMUST00000226310] [ENSMUST00000226565] [ENSMUST00000228437] [ENSMUST00000228930]
PDB Structure
Solution structure of PHD domain in PHD finger protein 7 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000022459
AA Change: E165K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022459
Gene: ENSMUSG00000021902
AA Change: E165K

DomainStartEndE-ValueType
PHD 97 145 8.45e-3 SMART
RING 160 207 7.46e-1 SMART
RING 250 300 4.87e0 SMART
PHD 252 301 1.16e0 SMART
Predicted Effect silent
Transcript: ENSMUST00000226310
Predicted Effect probably damaging
Transcript: ENSMUST00000226565
AA Change: E165K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228437
Predicted Effect probably benign
Transcript: ENSMUST00000228930
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spermatogenesis is a complex process regulated by extracellular and intracellular factors as well as cellular interactions among interstitial cells of the testis, Sertoli cells, and germ cells. This gene is expressed in the testis in Sertoli cells but not germ cells. The protein encoded by this gene contains plant homeodomain (PHD) finger domains, also known as leukemia associated protein (LAP) domains, believed to be involved in transcriptional regulation. The protein, which localizes to the nucleus of transfected cells, has been implicated in the transcriptional regulation of spermatogenesis. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 G A 4: 139,633,957 V72M probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atl3 T C 19: 7,510,040 S107P probably benign Het
Brpf3 T C 17: 28,810,572 L502P possibly damaging Het
C6 T A 15: 4,789,505 S440T probably damaging Het
Car3 A G 3: 14,870,064 H177R probably benign Het
Ccdc148 A G 2: 58,934,500 W310R probably damaging Het
Cchcr1 C T 17: 35,526,486 T401I probably benign Het
Cdk13 G A 13: 17,772,576 probably benign Het
Celsr2 A G 3: 108,398,588 S2067P probably benign Het
Chrng A T 1: 87,209,453 T278S probably benign Het
Clec14a T A 12: 58,267,757 T360S probably benign Het
Cr2 A G 1: 195,154,225 Y877H probably damaging Het
Crybg3 A T 16: 59,559,337 L518* probably null Het
Cyp2c38 A T 19: 39,438,242 V205D possibly damaging Het
Dlg5 G A 14: 24,157,799 P1113L probably damaging Het
Dnah7a A T 1: 53,547,297 V1465E probably benign Het
Fbn1 C T 2: 125,306,471 C2619Y probably damaging Het
Fbxl4 A G 4: 22,376,869 T102A probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gimap8 A C 6: 48,659,155 N618T probably damaging Het
Gk5 T A 9: 96,153,107 F286L probably damaging Het
Gm13078 A T 4: 143,728,515 Y461F probably benign Het
Gucy2c G A 6: 136,697,968 S1039L probably benign Het
Hmcn2 C T 2: 31,380,233 P1161S probably damaging Het
Hnrnpa2b1 A T 6: 51,466,937 V78E possibly damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ltbp3 C T 19: 5,747,006 S387L possibly damaging Het
Mrpl48 A G 7: 100,565,201 V64A probably benign Het
Muc16 T C 9: 18,558,427 Y7284C probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myh4 A T 11: 67,256,281 D1584V probably damaging Het
Myl7 A G 11: 5,897,140 F138L possibly damaging Het
Nek5 T C 8: 22,090,517 K395R probably benign Het
Olfr1328 T A 4: 118,934,264 T195S probably damaging Het
Olfr1448 A G 19: 12,920,162 L49P probably damaging Het
Olfr720 A T 14: 14,176,075 D2E probably benign Het
Pnpla6 A G 8: 3,541,591 Y1213C probably benign Het
Ppp1r9a A T 6: 5,143,238 K1005N probably benign Het
Ppp2r3d A T 9: 124,440,873 D8E probably damaging Het
Ptprn2 C A 12: 116,841,320 R152S probably benign Het
Smc5 A T 19: 23,229,017 D724E probably benign Het
Snx30 T C 4: 59,885,047 V229A probably benign Het
Spata31d1c A C 13: 65,036,000 N452T probably benign Het
Tacc2 C T 7: 130,716,814 probably benign Het
Thsd7a C T 6: 12,379,438 D996N Het
Tubb2b A G 13: 34,128,135 L225P probably damaging Het
Ubr4 A G 4: 139,413,480 T1237A possibly damaging Het
Unc50 G A 1: 37,431,415 R40Q possibly damaging Het
Usp31 T C 7: 121,649,181 E1013G possibly damaging Het
Vwa5a A G 9: 38,733,963 D448G probably benign Het
Wnt5a T C 14: 28,518,372 S160P possibly damaging Het
Zfp618 T A 4: 63,132,717 Y578* probably null Het
Zfp804a C T 2: 82,259,060 Q1078* probably null Het
Zfp808 C T 13: 62,171,411 T131M probably benign Het
Other mutations in Phf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0021:Phf7 UTSW 14 31238486 splice site probably benign
R0021:Phf7 UTSW 14 31238486 splice site probably benign
R1331:Phf7 UTSW 14 31240405 nonsense probably null
R1912:Phf7 UTSW 14 31240324 missense possibly damaging 0.64
R5185:Phf7 UTSW 14 31248037 splice site probably null
R6129:Phf7 UTSW 14 31240863 missense probably damaging 1.00
R7035:Phf7 UTSW 14 31239226 missense probably damaging 1.00
R7358:Phf7 UTSW 14 31241788 missense probably benign 0.01
R7427:Phf7 UTSW 14 31240413 missense possibly damaging 0.83
R7428:Phf7 UTSW 14 31240413 missense possibly damaging 0.83
R7538:Phf7 UTSW 14 31238429 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCAGCTCCTAGGCACATG -3'
(R):5'- AGTGTACCGATTCACTGAGCAC -3'

Sequencing Primer
(F):5'- TGCCTGCAGTACGGAGTTC -3'
(R):5'- CGATTCACTGAGCACCAAGC -3'
Posted On2019-11-12