Incidental Mutation 'R7666:Ltbp3'
ID591957
Institutional Source Beutler Lab
Gene Symbol Ltbp3
Ensembl Gene ENSMUSG00000024940
Gene Namelatent transforming growth factor beta binding protein 3
SynonymsLtbp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R7666 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5740904-5758532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5747006 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 387 (S387L)
Ref Sequence ENSEMBL: ENSMUSP00000080214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081496
AA Change: S387L

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: S387L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 G A 4: 139,633,957 V72M probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atl3 T C 19: 7,510,040 S107P probably benign Het
Brpf3 T C 17: 28,810,572 L502P possibly damaging Het
C6 T A 15: 4,789,505 S440T probably damaging Het
Car3 A G 3: 14,870,064 H177R probably benign Het
Ccdc148 A G 2: 58,934,500 W310R probably damaging Het
Cchcr1 C T 17: 35,526,486 T401I probably benign Het
Cdk13 G A 13: 17,772,576 probably benign Het
Celsr2 A G 3: 108,398,588 S2067P probably benign Het
Chrng A T 1: 87,209,453 T278S probably benign Het
Clec14a T A 12: 58,267,757 T360S probably benign Het
Cr2 A G 1: 195,154,225 Y877H probably damaging Het
Crybg3 A T 16: 59,559,337 L518* probably null Het
Cyp2c38 A T 19: 39,438,242 V205D possibly damaging Het
Dlg5 G A 14: 24,157,799 P1113L probably damaging Het
Dnah7a A T 1: 53,547,297 V1465E probably benign Het
Fbn1 C T 2: 125,306,471 C2619Y probably damaging Het
Fbxl4 A G 4: 22,376,869 T102A probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gimap8 A C 6: 48,659,155 N618T probably damaging Het
Gk5 T A 9: 96,153,107 F286L probably damaging Het
Gm13078 A T 4: 143,728,515 Y461F probably benign Het
Gucy2c G A 6: 136,697,968 S1039L probably benign Het
Hmcn2 C T 2: 31,380,233 P1161S probably damaging Het
Hnrnpa2b1 A T 6: 51,466,937 V78E possibly damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Mrpl48 A G 7: 100,565,201 V64A probably benign Het
Muc16 T C 9: 18,558,427 Y7284C probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myh4 A T 11: 67,256,281 D1584V probably damaging Het
Myl7 A G 11: 5,897,140 F138L possibly damaging Het
Nek5 T C 8: 22,090,517 K395R probably benign Het
Olfr1328 T A 4: 118,934,264 T195S probably damaging Het
Olfr1448 A G 19: 12,920,162 L49P probably damaging Het
Olfr720 A T 14: 14,176,075 D2E probably benign Het
Phf7 C T 14: 31,240,354 E165K probably damaging Het
Pnpla6 A G 8: 3,541,591 Y1213C probably benign Het
Ppp1r9a A T 6: 5,143,238 K1005N probably benign Het
Ppp2r3d A T 9: 124,440,873 D8E probably damaging Het
Ptprn2 C A 12: 116,841,320 R152S probably benign Het
Smc5 A T 19: 23,229,017 D724E probably benign Het
Snx30 T C 4: 59,885,047 V229A probably benign Het
Spata31d1c A C 13: 65,036,000 N452T probably benign Het
Tacc2 C T 7: 130,716,814 probably benign Het
Thsd7a C T 6: 12,379,438 D996N Het
Tubb2b A G 13: 34,128,135 L225P probably damaging Het
Ubr4 A G 4: 139,413,480 T1237A possibly damaging Het
Unc50 G A 1: 37,431,415 R40Q possibly damaging Het
Usp31 T C 7: 121,649,181 E1013G possibly damaging Het
Vwa5a A G 9: 38,733,963 D448G probably benign Het
Wnt5a T C 14: 28,518,372 S160P possibly damaging Het
Zfp618 T A 4: 63,132,717 Y578* probably null Het
Zfp804a C T 2: 82,259,060 Q1078* probably null Het
Zfp808 C T 13: 62,171,411 T131M probably benign Het
Other mutations in Ltbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5756016 missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5754019 missense probably benign 0.26
IGL01517:Ltbp3 APN 19 5757732 missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5747839 missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5757443 missense probably damaging 0.98
csp UTSW 19 5747688 missense probably damaging 1.00
lilia UTSW 19 5747857 critical splice donor site probably null
Rapunzel UTSW 19 5753942 nonsense probably null
PIT4305001:Ltbp3 UTSW 19 5752067 missense probably damaging 0.99
PIT4453001:Ltbp3 UTSW 19 5757794 missense probably damaging 0.97
PIT4480001:Ltbp3 UTSW 19 5751226 missense possibly damaging 0.73
R0211:Ltbp3 UTSW 19 5752143 critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5746748 splice site probably benign
R1103:Ltbp3 UTSW 19 5747411 critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5747412 critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5745428 splice site probably benign
R1510:Ltbp3 UTSW 19 5748887 missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5746967 missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5751754 missense probably benign 0.02
R1752:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5753942 nonsense probably null
R1866:Ltbp3 UTSW 19 5747849 missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5758079 missense probably benign 0.15
R2211:Ltbp3 UTSW 19 5753962 missense possibly damaging 0.79
R2239:Ltbp3 UTSW 19 5751523 nonsense probably null
R2261:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2263:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2380:Ltbp3 UTSW 19 5751523 nonsense probably null
R2412:Ltbp3 UTSW 19 5746645 missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2449:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3056:Ltbp3 UTSW 19 5751406 missense probably benign 0.11
R3080:Ltbp3 UTSW 19 5756888 frame shift probably null
R3863:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3864:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3951:Ltbp3 UTSW 19 5756001 missense probably damaging 1.00
R3961:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3962:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3963:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3972:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4028:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4031:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4041:Ltbp3 UTSW 19 5751871 missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5742320 missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5756582 critical splice acceptor site probably null
R4525:Ltbp3 UTSW 19 5746359 missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5748786 intron probably null
R4794:Ltbp3 UTSW 19 5756679 missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5753927 critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5756823 missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5747821 missense probably benign
R5771:Ltbp3 UTSW 19 5747544 missense probably damaging 1.00
R6021:Ltbp3 UTSW 19 5753680 missense probably benign 0.00
R6053:Ltbp3 UTSW 19 5752094 missense probably damaging 0.98
R6321:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R6339:Ltbp3 UTSW 19 5747477 missense probably damaging 1.00
R6371:Ltbp3 UTSW 19 5745772 splice site probably null
R6709:Ltbp3 UTSW 19 5747857 critical splice donor site probably null
X0066:Ltbp3 UTSW 19 5751277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTGTGTGGAGCAGCTTGC -3'
(R):5'- AGAGTCGCTCTGAATTTGCTC -3'

Sequencing Primer
(F):5'- CAGCTTGCTGCCATGTTATG -3'
(R):5'- GACCTCTGATCTCAGGTCATGTGAC -3'
Posted On2019-11-12