Incidental Mutation 'R7666:Smc5'
ID591960
Institutional Source Beutler Lab
Gene Symbol Smc5
Ensembl Gene ENSMUSG00000024943
Gene Namestructural maintenance of chromosomes 5
SynonymsSmc5l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7666 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location23206451-23273897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23229017 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 724 (D724E)
Ref Sequence ENSEMBL: ENSMUSP00000084837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087556] [ENSMUST00000223934] [ENSMUST00000226111]
Predicted Effect probably benign
Transcript: ENSMUST00000087556
AA Change: D724E

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000084837
Gene: ENSMUSG00000024943
AA Change: D724E

DomainStartEndE-ValueType
Pfam:SMC_N 52 1057 9.2e-19 PFAM
Pfam:AAA_23 55 456 1.2e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000223934
AA Change: D724E

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000226111
AA Change: D648E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout in embryonic stem cells causes abnormal mitosis, increased apoptosis and a shift from pluripotency to differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 G A 4: 139,633,957 V72M probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atl3 T C 19: 7,510,040 S107P probably benign Het
Brpf3 T C 17: 28,810,572 L502P possibly damaging Het
C6 T A 15: 4,789,505 S440T probably damaging Het
Car3 A G 3: 14,870,064 H177R probably benign Het
Ccdc148 A G 2: 58,934,500 W310R probably damaging Het
Cchcr1 C T 17: 35,526,486 T401I probably benign Het
Cdk13 G A 13: 17,772,576 probably benign Het
Celsr2 A G 3: 108,398,588 S2067P probably benign Het
Chrng A T 1: 87,209,453 T278S probably benign Het
Clec14a T A 12: 58,267,757 T360S probably benign Het
Cr2 A G 1: 195,154,225 Y877H probably damaging Het
Crybg3 A T 16: 59,559,337 L518* probably null Het
Cyp2c38 A T 19: 39,438,242 V205D possibly damaging Het
Dlg5 G A 14: 24,157,799 P1113L probably damaging Het
Dnah7a A T 1: 53,547,297 V1465E probably benign Het
Fbn1 C T 2: 125,306,471 C2619Y probably damaging Het
Fbxl4 A G 4: 22,376,869 T102A probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gimap8 A C 6: 48,659,155 N618T probably damaging Het
Gk5 T A 9: 96,153,107 F286L probably damaging Het
Gm13078 A T 4: 143,728,515 Y461F probably benign Het
Gucy2c G A 6: 136,697,968 S1039L probably benign Het
Hmcn2 C T 2: 31,380,233 P1161S probably damaging Het
Hnrnpa2b1 A T 6: 51,466,937 V78E possibly damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ltbp3 C T 19: 5,747,006 S387L possibly damaging Het
Mrpl48 A G 7: 100,565,201 V64A probably benign Het
Muc16 T C 9: 18,558,427 Y7284C probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myh4 A T 11: 67,256,281 D1584V probably damaging Het
Myl7 A G 11: 5,897,140 F138L possibly damaging Het
Nek5 T C 8: 22,090,517 K395R probably benign Het
Olfr1328 T A 4: 118,934,264 T195S probably damaging Het
Olfr1448 A G 19: 12,920,162 L49P probably damaging Het
Olfr720 A T 14: 14,176,075 D2E probably benign Het
Phf7 C T 14: 31,240,354 E165K probably damaging Het
Pnpla6 A G 8: 3,541,591 Y1213C probably benign Het
Ppp1r9a A T 6: 5,143,238 K1005N probably benign Het
Ppp2r3d A T 9: 124,440,873 D8E probably damaging Het
Ptprn2 C A 12: 116,841,320 R152S probably benign Het
Snx30 T C 4: 59,885,047 V229A probably benign Het
Spata31d1c A C 13: 65,036,000 N452T probably benign Het
Tacc2 C T 7: 130,716,814 probably benign Het
Thsd7a C T 6: 12,379,438 D996N Het
Tubb2b A G 13: 34,128,135 L225P probably damaging Het
Ubr4 A G 4: 139,413,480 T1237A possibly damaging Het
Unc50 G A 1: 37,431,415 R40Q possibly damaging Het
Usp31 T C 7: 121,649,181 E1013G possibly damaging Het
Vwa5a A G 9: 38,733,963 D448G probably benign Het
Wnt5a T C 14: 28,518,372 S160P possibly damaging Het
Zfp618 T A 4: 63,132,717 Y578* probably null Het
Zfp804a C T 2: 82,259,060 Q1078* probably null Het
Zfp808 C T 13: 62,171,411 T131M probably benign Het
Other mutations in Smc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Smc5 APN 19 23235965 missense probably damaging 1.00
IGL01070:Smc5 APN 19 23231601 missense possibly damaging 0.86
IGL01315:Smc5 APN 19 23231604 missense probably benign
IGL01879:Smc5 APN 19 23228184 missense probably damaging 0.97
IGL01902:Smc5 APN 19 23259768 missense possibly damaging 0.85
IGL02016:Smc5 APN 19 23273712 missense probably benign 0.00
IGL02186:Smc5 APN 19 23231859 missense probably damaging 1.00
IGL02383:Smc5 APN 19 23214632 splice site probably benign
IGL02447:Smc5 APN 19 23257492 missense probably benign 0.01
IGL02534:Smc5 APN 19 23228172 critical splice donor site probably null
IGL02834:Smc5 APN 19 23257604 missense probably benign 0.30
IGL03290:Smc5 APN 19 23273658 missense probably benign 0.19
R0722:Smc5 UTSW 19 23208927 missense probably damaging 0.99
R0893:Smc5 UTSW 19 23263653 missense possibly damaging 0.67
R0970:Smc5 UTSW 19 23238998 missense probably damaging 1.00
R1281:Smc5 UTSW 19 23235883 missense probably benign
R1368:Smc5 UTSW 19 23210443 missense probably damaging 1.00
R2092:Smc5 UTSW 19 23238899 missense probably benign
R3721:Smc5 UTSW 19 23210492 missense probably benign 0.21
R4382:Smc5 UTSW 19 23268846 missense probably benign 0.39
R4735:Smc5 UTSW 19 23242705 missense probably benign
R4936:Smc5 UTSW 19 23234003 missense probably damaging 1.00
R5306:Smc5 UTSW 19 23259645 critical splice donor site probably null
R5754:Smc5 UTSW 19 23244103 missense possibly damaging 0.92
R6175:Smc5 UTSW 19 23214170 missense possibly damaging 0.60
R6313:Smc5 UTSW 19 23208948 nonsense probably null
R6527:Smc5 UTSW 19 23228190 missense probably benign 0.00
R6611:Smc5 UTSW 19 23228919 missense probably benign 0.13
R6750:Smc5 UTSW 19 23242640 missense probably damaging 1.00
R6801:Smc5 UTSW 19 23214646 missense probably benign 0.34
R6821:Smc5 UTSW 19 23242787 missense probably benign 0.20
R7002:Smc5 UTSW 19 23231883 missense probably benign 0.00
R7198:Smc5 UTSW 19 23259700 nonsense probably null
R7386:Smc5 UTSW 19 23215175 missense possibly damaging 0.59
R7439:Smc5 UTSW 19 23242700 missense probably damaging 0.97
R7596:Smc5 UTSW 19 23214169 missense probably damaging 0.99
R7760:Smc5 UTSW 19 23235890 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGATGATTTCTCATAAAGTCCTCC -3'
(R):5'- GCTGGTCATATAGCTCCACAG -3'

Sequencing Primer
(F):5'- CTTACCTTTACAAGGCCTG -3'
(R):5'- AGCTCCACAGTATATTTTGATCCTG -3'
Posted On2019-11-12