Incidental Mutation 'R7666:Cyp2c38'
ID591961
Institutional Source Beutler Lab
Gene Symbol Cyp2c38
Ensembl Gene ENSMUSG00000032808
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 38
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7666 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39389556-39463075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39438242 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 205 (V205D)
Ref Sequence ENSEMBL: ENSMUSP00000044722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035488]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035488
AA Change: V205D

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044722
Gene: ENSMUSG00000032808
AA Change: V205D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 1.5e-161 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 G A 4: 139,633,957 V72M probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atl3 T C 19: 7,510,040 S107P probably benign Het
Brpf3 T C 17: 28,810,572 L502P possibly damaging Het
C6 T A 15: 4,789,505 S440T probably damaging Het
Car3 A G 3: 14,870,064 H177R probably benign Het
Ccdc148 A G 2: 58,934,500 W310R probably damaging Het
Cchcr1 C T 17: 35,526,486 T401I probably benign Het
Cdk13 G A 13: 17,772,576 probably benign Het
Celsr2 A G 3: 108,398,588 S2067P probably benign Het
Chrng A T 1: 87,209,453 T278S probably benign Het
Clec14a T A 12: 58,267,757 T360S probably benign Het
Cr2 A G 1: 195,154,225 Y877H probably damaging Het
Crybg3 A T 16: 59,559,337 L518* probably null Het
Dlg5 G A 14: 24,157,799 P1113L probably damaging Het
Dnah7a A T 1: 53,547,297 V1465E probably benign Het
Fbn1 C T 2: 125,306,471 C2619Y probably damaging Het
Fbxl4 A G 4: 22,376,869 T102A probably benign Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Gimap8 A C 6: 48,659,155 N618T probably damaging Het
Gk5 T A 9: 96,153,107 F286L probably damaging Het
Gm13078 A T 4: 143,728,515 Y461F probably benign Het
Gucy2c G A 6: 136,697,968 S1039L probably benign Het
Hmcn2 C T 2: 31,380,233 P1161S probably damaging Het
Hnrnpa2b1 A T 6: 51,466,937 V78E possibly damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ltbp3 C T 19: 5,747,006 S387L possibly damaging Het
Mrpl48 A G 7: 100,565,201 V64A probably benign Het
Muc16 T C 9: 18,558,427 Y7284C probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myh4 A T 11: 67,256,281 D1584V probably damaging Het
Myl7 A G 11: 5,897,140 F138L possibly damaging Het
Nek5 T C 8: 22,090,517 K395R probably benign Het
Olfr1328 T A 4: 118,934,264 T195S probably damaging Het
Olfr1448 A G 19: 12,920,162 L49P probably damaging Het
Olfr720 A T 14: 14,176,075 D2E probably benign Het
Phf7 C T 14: 31,240,354 E165K probably damaging Het
Pnpla6 A G 8: 3,541,591 Y1213C probably benign Het
Ppp1r9a A T 6: 5,143,238 K1005N probably benign Het
Ppp2r3d A T 9: 124,440,873 D8E probably damaging Het
Ptprn2 C A 12: 116,841,320 R152S probably benign Het
Smc5 A T 19: 23,229,017 D724E probably benign Het
Snx30 T C 4: 59,885,047 V229A probably benign Het
Spata31d1c A C 13: 65,036,000 N452T probably benign Het
Tacc2 C T 7: 130,716,814 probably benign Het
Thsd7a C T 6: 12,379,438 D996N Het
Tubb2b A G 13: 34,128,135 L225P probably damaging Het
Ubr4 A G 4: 139,413,480 T1237A possibly damaging Het
Unc50 G A 1: 37,431,415 R40Q possibly damaging Het
Usp31 T C 7: 121,649,181 E1013G possibly damaging Het
Vwa5a A G 9: 38,733,963 D448G probably benign Het
Wnt5a T C 14: 28,518,372 S160P possibly damaging Het
Zfp618 T A 4: 63,132,717 Y578* probably null Het
Zfp804a C T 2: 82,259,060 Q1078* probably null Het
Zfp808 C T 13: 62,171,411 T131M probably benign Het
Other mutations in Cyp2c38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Cyp2c38 APN 19 39460725 nonsense probably null
IGL01109:Cyp2c38 APN 19 39462885 critical splice donor site probably null
IGL01521:Cyp2c38 APN 19 39460670 missense probably damaging 0.99
IGL02036:Cyp2c38 APN 19 39460316 missense probably null 0.97
IGL02187:Cyp2c38 APN 19 39436205 missense probably benign 0.14
IGL02954:Cyp2c38 APN 19 39391076 missense probably damaging 0.99
R0479:Cyp2c38 UTSW 19 39463005 missense probably damaging 0.99
R0684:Cyp2c38 UTSW 19 39391056 missense probably damaging 0.99
R0919:Cyp2c38 UTSW 19 39404669 missense probably benign 0.07
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1642:Cyp2c38 UTSW 19 39401709 missense probably damaging 1.00
R1715:Cyp2c38 UTSW 19 39404795 missense probably benign 0.25
R1900:Cyp2c38 UTSW 19 39438312 missense probably benign 0.40
R1954:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R1955:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R2860:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2861:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2862:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R3084:Cyp2c38 UTSW 19 39401701 missense probably benign 0.00
R3727:Cyp2c38 UTSW 19 39392295 splice site probably benign
R4648:Cyp2c38 UTSW 19 39460688 missense probably benign 0.05
R5119:Cyp2c38 UTSW 19 39460621 missense probably damaging 1.00
R5636:Cyp2c38 UTSW 19 39438306 nonsense probably null
R5651:Cyp2c38 UTSW 19 39460712 missense probably damaging 0.99
R6263:Cyp2c38 UTSW 19 39392215 missense probably damaging 1.00
R6384:Cyp2c38 UTSW 19 39392293 splice site probably null
R6853:Cyp2c38 UTSW 19 39438304 missense probably benign 0.02
R6915:Cyp2c38 UTSW 19 39436068 missense probably damaging 0.99
R7201:Cyp2c38 UTSW 19 39401776 missense probably damaging 1.00
R7570:Cyp2c38 UTSW 19 39404743 missense possibly damaging 0.76
R7625:Cyp2c38 UTSW 19 39462924 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GAGCTAGAAGAATTGATCCAACCC -3'
(R):5'- AGCAACATATCTTCTTTGCCTAGC -3'

Sequencing Primer
(F):5'- AAGGCTGATGACTTCATTGCAG -3'
(R):5'- ACATATCTTCTTTGCCTAGCTTAATG -3'
Posted On2019-11-12