Incidental Mutation 'R7666:Fthl17b'
ID591963
Institutional Source Beutler Lab
Gene Symbol Fthl17b
Ensembl Gene ENSMUSG00000078208
Gene Nameferritin, heavy polypeptide-like 17, member B
SynonymsGm5634
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7666 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location8962134-8962975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8962808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 8 (V8M)
Ref Sequence ENSEMBL: ENSMUSP00000100623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105006
AA Change: V8M

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100623
Gene: ENSMUSG00000078208
AA Change: V8M

DomainStartEndE-ValueType
Pfam:Ferritin 17 158 1.1e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh4a1 G A 4: 139,633,957 V72M probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atl3 T C 19: 7,510,040 S107P probably benign Het
Brpf3 T C 17: 28,810,572 L502P possibly damaging Het
C6 T A 15: 4,789,505 S440T probably damaging Het
Car3 A G 3: 14,870,064 H177R probably benign Het
Ccdc148 A G 2: 58,934,500 W310R probably damaging Het
Cchcr1 C T 17: 35,526,486 T401I probably benign Het
Cdk13 G A 13: 17,772,576 probably benign Het
Celsr2 A G 3: 108,398,588 S2067P probably benign Het
Chrng A T 1: 87,209,453 T278S probably benign Het
Clec14a T A 12: 58,267,757 T360S probably benign Het
Cr2 A G 1: 195,154,225 Y877H probably damaging Het
Crybg3 A T 16: 59,559,337 L518* probably null Het
Cyp2c38 A T 19: 39,438,242 V205D possibly damaging Het
Dlg5 G A 14: 24,157,799 P1113L probably damaging Het
Dnah7a A T 1: 53,547,297 V1465E probably benign Het
Fbn1 C T 2: 125,306,471 C2619Y probably damaging Het
Fbxl4 A G 4: 22,376,869 T102A probably benign Het
Gimap8 A C 6: 48,659,155 N618T probably damaging Het
Gk5 T A 9: 96,153,107 F286L probably damaging Het
Gm13078 A T 4: 143,728,515 Y461F probably benign Het
Gucy2c G A 6: 136,697,968 S1039L probably benign Het
Hmcn2 C T 2: 31,380,233 P1161S probably damaging Het
Hnrnpa2b1 A T 6: 51,466,937 V78E possibly damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ltbp3 C T 19: 5,747,006 S387L possibly damaging Het
Mrpl48 A G 7: 100,565,201 V64A probably benign Het
Muc16 T C 9: 18,558,427 Y7284C probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myh4 A T 11: 67,256,281 D1584V probably damaging Het
Myl7 A G 11: 5,897,140 F138L possibly damaging Het
Nek5 T C 8: 22,090,517 K395R probably benign Het
Olfr1328 T A 4: 118,934,264 T195S probably damaging Het
Olfr1448 A G 19: 12,920,162 L49P probably damaging Het
Olfr720 A T 14: 14,176,075 D2E probably benign Het
Phf7 C T 14: 31,240,354 E165K probably damaging Het
Pnpla6 A G 8: 3,541,591 Y1213C probably benign Het
Ppp1r9a A T 6: 5,143,238 K1005N probably benign Het
Ppp2r3d A T 9: 124,440,873 D8E probably damaging Het
Ptprn2 C A 12: 116,841,320 R152S probably benign Het
Smc5 A T 19: 23,229,017 D724E probably benign Het
Snx30 T C 4: 59,885,047 V229A probably benign Het
Spata31d1c A C 13: 65,036,000 N452T probably benign Het
Tacc2 C T 7: 130,716,814 probably benign Het
Thsd7a C T 6: 12,379,438 D996N Het
Tubb2b A G 13: 34,128,135 L225P probably damaging Het
Ubr4 A G 4: 139,413,480 T1237A possibly damaging Het
Unc50 G A 1: 37,431,415 R40Q possibly damaging Het
Usp31 T C 7: 121,649,181 E1013G possibly damaging Het
Vwa5a A G 9: 38,733,963 D448G probably benign Het
Wnt5a T C 14: 28,518,372 S160P possibly damaging Het
Zfp618 T A 4: 63,132,717 Y578* probably null Het
Zfp804a C T 2: 82,259,060 Q1078* probably null Het
Zfp808 C T 13: 62,171,411 T131M probably benign Het
Other mutations in Fthl17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7417:Fthl17b UTSW X 8962804 missense possibly damaging 0.95
R7417:Fthl17b UTSW X 8962808 missense possibly damaging 0.85
R7418:Fthl17b UTSW X 8962804 missense possibly damaging 0.95
R7418:Fthl17b UTSW X 8962808 missense possibly damaging 0.85
R7492:Fthl17b UTSW X 8962804 missense possibly damaging 0.95
R7492:Fthl17b UTSW X 8962808 missense possibly damaging 0.85
R7663:Fthl17b UTSW X 8962804 missense possibly damaging 0.95
R7663:Fthl17b UTSW X 8962808 missense possibly damaging 0.85
R7664:Fthl17b UTSW X 8962804 missense possibly damaging 0.95
R7664:Fthl17b UTSW X 8962808 missense possibly damaging 0.85
R7666:Fthl17b UTSW X 8962804 missense possibly damaging 0.95
R7787:Fthl17b UTSW X 8962804 missense possibly damaging 0.95
R7787:Fthl17b UTSW X 8962808 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACGCTTATTCTGCAGGTGC -3'
(R):5'- GCAGGAACAGCCATTTGGATC -3'

Sequencing Primer
(F):5'- AGGTGCATGAACATCTCTGC -3'
(R):5'- GGAACAGCCATTTGGATCACTGC -3'
Posted On2019-11-12