Incidental Mutation 'R7667:Il1rl2'
ID 591965
Institutional Source Beutler Lab
Gene Symbol Il1rl2
Ensembl Gene ENSMUSG00000070942
Gene Name interleukin 1 receptor-like 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7667 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 40324610-40367562 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 40365253 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 511 (H511Q)
Ref Sequence ENSEMBL: ENSMUSP00000092630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095020] [ENSMUST00000194296]
AlphaFold Q9ERS7
Predicted Effect probably damaging
Transcript: ENSMUST00000095020
AA Change: H511Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092630
Gene: ENSMUSG00000070942
AA Change: H511Q

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194296
AA Change: H511Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142248
Gene: ENSMUSG00000070942
AA Change: H511Q

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 receptor family. An experiment with transient gene expression demonstrated that this receptor was incapable of binding to interleukin 1 alpha and interleukin 1 beta with high affinity. This gene and four other interleukin 1 receptor family genes, including interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2), interleukin 1 receptor-like 1 (IL1RL1), and interleukin 18 receptor 1 (IL18R1), form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are viable and overtly normal and have normal skin in an unchallenged context. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,333,952 probably null Het
Adgrf5 A C 17: 43,446,039 I675L probably benign Het
Arhgap24 T A 5: 102,878,457 M248K probably benign Het
Chl1 G A 6: 103,695,495 D566N possibly damaging Het
Cntn4 A T 6: 106,679,895 I908F possibly damaging Het
Cyld T C 8: 88,742,302 I752T probably benign Het
Cyp26a1 C A 19: 37,700,624 L336I possibly damaging Het
Dlg2 A G 7: 92,438,156 probably null Het
Dmkn G A 7: 30,777,609 G446D probably damaging Het
Dnajc25 T C 4: 59,020,356 Y260H probably damaging Het
Dnm3 C A 1: 162,011,830 R186L probably damaging Het
Dst C T 1: 34,179,035 H1519Y possibly damaging Het
Eif1ad A G 19: 5,368,215 H9R probably damaging Het
Epha3 A T 16: 63,566,600 I891N probably benign Het
Epx T C 11: 87,874,311 T187A probably damaging Het
Fbln2 T G 6: 91,233,667 Y198D probably damaging Het
Fhod3 A G 18: 25,001,944 I371V probably benign Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gm4922 C T 10: 18,784,348 V209I probably damaging Het
Gucy1a2 G A 9: 3,759,580 G462D probably damaging Het
Gzmd T C 14: 56,131,252 T62A probably damaging Het
Hnrnpul1 A T 7: 25,754,421 L72Q probably damaging Het
Ifi211 A T 1: 173,899,454 W375R probably damaging Het
Kcnn2 A T 18: 45,559,438 H27L possibly damaging Het
Kng2 A G 16: 22,988,232 Y406H probably damaging Het
Lama1 A G 17: 67,780,597 E1491G Het
Lmf1 T C 17: 25,654,608 probably null Het
Med24 T C 11: 98,713,164 N417S possibly damaging Het
Mfsd4b5 T C 10: 39,974,800 E60G probably benign Het
Myo7b A G 18: 31,961,905 V1879A probably benign Het
Myrfl T A 10: 116,839,353 N225I possibly damaging Het
Naaladl2 A C 3: 24,413,348 probably null Het
Ndrg1 C T 15: 66,948,394 D64N probably damaging Het
Olfr1057 A G 2: 86,375,181 I77T probably damaging Het
Olfr820 T C 10: 130,017,534 Y58H probably damaging Het
Rasa3 A C 8: 13,588,015 L343R probably benign Het
Ros1 T G 10: 52,163,971 K308T probably damaging Het
Rp1l1 A G 14: 64,029,803 Y946C probably benign Het
Rpl13a A T 7: 45,126,173 L156Q probably damaging Het
Samd9l A G 6: 3,375,975 F429L possibly damaging Het
Slc25a25 A G 2: 32,451,209 V39A probably benign Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Sspo G A 6: 48,475,371 W2756* probably null Het
Sult6b2 T A 6: 142,786,359 N274I probably benign Het
Tbc1d14 G A 5: 36,495,038 R667W probably damaging Het
Tg T C 15: 66,715,163 S1597P probably damaging Het
Thy1 A G 9: 44,047,435 D158G probably damaging Het
Tns4 T C 11: 99,071,470 Y567C probably damaging Het
Vmn1r170 A G 7: 23,607,048 R292G probably damaging Het
Vmn2r120 C A 17: 57,536,657 R62S probably benign Het
Vmn2r88 T G 14: 51,417,989 C552G Het
Xpo4 T A 14: 57,589,959 I927F probably damaging Het
Zc3h7a A T 16: 11,139,026 C906* probably null Het
Zdhhc22 T C 12: 86,983,388 D262G probably benign Het
Zfc3h1 C T 10: 115,410,701 Q898* probably null Het
Zfp280d T A 9: 72,301,965 S126T probably damaging Het
Zfp652 G T 11: 95,749,718 E156D probably benign Het
Zfp74 T C 7: 29,935,183 R367G probably damaging Het
Other mutations in Il1rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Il1rl2 APN 1 40356814 splice site probably null
IGL02490:Il1rl2 APN 1 40356812 splice site probably benign
IGL03201:Il1rl2 APN 1 40343040 missense possibly damaging 0.95
IGL03269:Il1rl2 APN 1 40365312 missense probably damaging 1.00
R0088:Il1rl2 UTSW 1 40365053 missense possibly damaging 0.87
R0418:Il1rl2 UTSW 1 40326502 missense unknown
R0504:Il1rl2 UTSW 1 40329056 missense probably benign 0.00
R1629:Il1rl2 UTSW 1 40356860 missense probably benign 0.02
R1679:Il1rl2 UTSW 1 40343160 missense probably benign 0.36
R1680:Il1rl2 UTSW 1 40351793 missense possibly damaging 0.61
R1892:Il1rl2 UTSW 1 40327534 missense probably damaging 1.00
R1938:Il1rl2 UTSW 1 40363324 missense probably damaging 1.00
R2020:Il1rl2 UTSW 1 40365214 missense probably damaging 0.98
R4193:Il1rl2 UTSW 1 40365048 missense probably damaging 1.00
R4364:Il1rl2 UTSW 1 40351791 missense probably benign
R4365:Il1rl2 UTSW 1 40351791 missense probably benign
R4657:Il1rl2 UTSW 1 40327310 intron probably benign
R4840:Il1rl2 UTSW 1 40327387 missense possibly damaging 0.84
R4890:Il1rl2 UTSW 1 40327310 intron probably benign
R5051:Il1rl2 UTSW 1 40343094 missense probably benign 0.03
R5239:Il1rl2 UTSW 1 40365095 missense probably benign 0.03
R5447:Il1rl2 UTSW 1 40329156 missense probably damaging 1.00
R6013:Il1rl2 UTSW 1 40351857 missense possibly damaging 0.82
R6162:Il1rl2 UTSW 1 40351878 missense probably damaging 1.00
R6244:Il1rl2 UTSW 1 40327566 missense possibly damaging 0.78
R6798:Il1rl2 UTSW 1 40365240 missense probably damaging 1.00
R7855:Il1rl2 UTSW 1 40343119 missense probably damaging 1.00
R7857:Il1rl2 UTSW 1 40327482 missense probably benign 0.44
R8255:Il1rl2 UTSW 1 40365311 missense probably damaging 1.00
R8903:Il1rl2 UTSW 1 40327370 critical splice acceptor site probably null
R9236:Il1rl2 UTSW 1 40329061 missense probably damaging 1.00
R9448:Il1rl2 UTSW 1 40327444 missense probably benign 0.36
R9485:Il1rl2 UTSW 1 40327310 intron probably benign
R9487:Il1rl2 UTSW 1 40327310 intron probably benign
R9621:Il1rl2 UTSW 1 40327310 intron probably benign
R9746:Il1rl2 UTSW 1 40365359 missense possibly damaging 0.94
Z1177:Il1rl2 UTSW 1 40327310 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTCTTTGTGGCACCAGAGTC -3'
(R):5'- GGATGTAGTGTGAGCCAACAC -3'

Sequencing Primer
(F):5'- ACCAGAGTCGTCTAGCTTCG -3'
(R):5'- TCTCAGGGAGTTATGAGCCC -3'
Posted On 2019-11-12