Mutagenetix > Incidental Mutation

Incidental Mutation 'R7667:Samd9l'

591974

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7667 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3375975 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 429 (F429L)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120087
AA Change: F429L

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: F429L

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (58/58)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam17	A	T	12: 21,333,952		probably null	Het
Adgrf5	A	C	17: 43,446,039	I675L	probably benign	Het
Arhgap24	T	A	5: 102,878,457	M248K	probably benign	Het
Chl1	G	A	6: 103,695,495	D566N	possibly damaging	Het
Cntn4	A	T	6: 106,679,895	I908F	possibly damaging	Het
Cyld	T	C	8: 88,742,302	I752T	probably benign	Het
Cyp26a1	C	A	19: 37,700,624	L336I	possibly damaging	Het
Dlg2	A	G	7: 92,438,156		probably null	Het
Dmkn	G	A	7: 30,777,609	G446D	probably damaging	Het
Dnajc25	T	C	4: 59,020,356	Y260H	probably damaging	Het
Dnm3	C	A	1: 162,011,830	R186L	probably damaging	Het
Dst	C	T	1: 34,179,035	H1519Y	possibly damaging	Het
Eif1ad	A	G	19: 5,368,215	H9R	probably damaging	Het
Epha3	A	T	16: 63,566,600	I891N	probably benign	Het
Epx	T	C	11: 87,874,311	T187A	probably damaging	Het
Fbln2	T	G	6: 91,233,667	Y198D	probably damaging	Het
Fhod3	A	G	18: 25,001,944	I371V	probably benign	Het
Gm11639	C	T	11: 104,751,911	T1120I	possibly damaging	Het
Gm4922	C	T	10: 18,784,348	V209I	probably damaging	Het
Gucy1a2	G	A	9: 3,759,580	G462D	probably damaging	Het
Gzmd	T	C	14: 56,131,252	T62A	probably damaging	Het
Hnrnpul1	A	T	7: 25,754,421	L72Q	probably damaging	Het
Ifi211	A	T	1: 173,899,454	W375R	probably damaging	Het
Il1rl2	C	A	1: 40,365,253	H511Q	probably damaging	Het
Kcnn2	A	T	18: 45,559,438	H27L	possibly damaging	Het
Kng2	A	G	16: 22,988,232	Y406H	probably damaging	Het
Lama1	A	G	17: 67,780,597	E1491G		Het
Lmf1	T	C	17: 25,654,608		probably null	Het
Med24	T	C	11: 98,713,164	N417S	possibly damaging	Het
Mfsd4b5	T	C	10: 39,974,800	E60G	probably benign	Het
Myo7b	A	G	18: 31,961,905	V1879A	probably benign	Het
Myrfl	T	A	10: 116,839,353	N225I	possibly damaging	Het
Naaladl2	A	C	3: 24,413,348		probably null	Het
Ndrg1	C	T	15: 66,948,394	D64N	probably damaging	Het
Olfr1057	A	G	2: 86,375,181	I77T	probably damaging	Het
Olfr820	T	C	10: 130,017,534	Y58H	probably damaging	Het
Rasa3	A	C	8: 13,588,015	L343R	probably benign	Het
Ros1	T	G	10: 52,163,971	K308T	probably damaging	Het
Rp1l1	A	G	14: 64,029,803	Y946C	probably benign	Het
Rpl13a	A	T	7: 45,126,173	L156Q	probably damaging	Het
Slc25a25	A	G	2: 32,451,209	V39A	probably benign	Het
Snrnp27	A	T	6: 86,680,953	I101K	possibly damaging	Het
Sspo	G	A	6: 48,475,371	W2756*	probably null	Het
Sult6b2	T	A	6: 142,786,359	N274I	probably benign	Het
Tbc1d14	G	A	5: 36,495,038	R667W	probably damaging	Het
Tg	T	C	15: 66,715,163	S1597P	probably damaging	Het
Thy1	A	G	9: 44,047,435	D158G	probably damaging	Het
Tns4	T	C	11: 99,071,470	Y567C	probably damaging	Het
Vmn1r170	A	G	7: 23,607,048	R292G	probably damaging	Het
Vmn2r120	C	A	17: 57,536,657	R62S	probably benign	Het
Vmn2r88	T	G	14: 51,417,989	C552G		Het
Xpo4	T	A	14: 57,589,959	I927F	probably damaging	Het
Zc3h7a	A	T	16: 11,139,026	C906*	probably null	Het
Zdhhc22	T	C	12: 86,983,388	D262G	probably benign	Het
Zfc3h1	C	T	10: 115,410,701	Q898*	probably null	Het
Zfp280d	T	A	9: 72,301,965	S126T	probably damaging	Het
Zfp652	G	T	11: 95,749,718	E156D	probably benign	Het
Zfp74	T	C	7: 29,935,183	R367G	probably damaging	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAGTCTACTCTGCCATTGC -3'
(R):5'- TTAAAGATGTGGACAGCGTCTAG -3'

Sequencing Primer
(F):5'- AAGATCCAGCTAGGTTGCTC -3'
(R):5'- CAGCGTCTAGAAAAGCGGCC -3'

Posted On

2019-11-12