Incidental Mutation 'R7667:Chl1'
ID591978
Institutional Source Beutler Lab
Gene Symbol Chl1
Ensembl Gene ENSMUSG00000030077
Gene Namecell adhesion molecule L1-like
SynonymsA530023M13Rik, LICAM2, close homolog of L1, CALL
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R7667 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location103510586-103750211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103695495 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 566 (D566N)
Ref Sequence ENSEMBL: ENSMUSP00000063933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066905
AA Change: D566N

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: D566N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203830
AA Change: D566N

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: D566N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203912
AA Change: D582N

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: D582N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 269 333 3.76e-17 SMART
IGc2 359 424 1.61e-7 SMART
IGc2 452 517 1.56e-5 SMART
IG 537 625 6.02e-7 SMART
IG_like 555 614 1.27e-1 SMART
FN3 628 711 2.24e-13 SMART
FN3 728 810 1.92e-3 SMART
FN3 826 917 2.3e-1 SMART
FN3 932 1018 4.09e-7 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Bravo_FIGEY 1067 1131 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205098
SMART Domains Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
FN3 4 67 4.4e-1 SMART
FN3 83 174 1.2e-3 SMART
FN3 189 275 2.1e-9 SMART
transmembrane domain 301 323 N/A INTRINSIC
Pfam:Bravo_FIGEY 324 409 3.6e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,333,952 probably null Het
Adgrf5 A C 17: 43,446,039 I675L probably benign Het
Arhgap24 T A 5: 102,878,457 M248K probably benign Het
Cntn4 A T 6: 106,679,895 I908F possibly damaging Het
Cyld T C 8: 88,742,302 I752T probably benign Het
Cyp26a1 C A 19: 37,700,624 L336I possibly damaging Het
Dlg2 A G 7: 92,438,156 probably null Het
Dmkn G A 7: 30,777,609 G446D probably damaging Het
Dnajc25 T C 4: 59,020,356 Y260H probably damaging Het
Dnm3 C A 1: 162,011,830 R186L probably damaging Het
Dst C T 1: 34,179,035 H1519Y possibly damaging Het
Eif1ad A G 19: 5,368,215 H9R probably damaging Het
Epha3 A T 16: 63,566,600 I891N probably benign Het
Epx T C 11: 87,874,311 T187A probably damaging Het
Fbln2 T G 6: 91,233,667 Y198D probably damaging Het
Fhod3 A G 18: 25,001,944 I371V probably benign Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gm4922 C T 10: 18,784,348 V209I probably damaging Het
Gucy1a2 G A 9: 3,759,580 G462D probably damaging Het
Gzmd T C 14: 56,131,252 T62A probably damaging Het
Hnrnpul1 A T 7: 25,754,421 L72Q probably damaging Het
Ifi211 A T 1: 173,899,454 W375R probably damaging Het
Il1rl2 C A 1: 40,365,253 H511Q probably damaging Het
Kcnn2 A T 18: 45,559,438 H27L possibly damaging Het
Kng2 A G 16: 22,988,232 Y406H probably damaging Het
Lama1 A G 17: 67,780,597 E1491G Het
Lmf1 T C 17: 25,654,608 probably null Het
Med24 T C 11: 98,713,164 N417S possibly damaging Het
Mfsd4b5 T C 10: 39,974,800 E60G probably benign Het
Myo7b A G 18: 31,961,905 V1879A probably benign Het
Myrfl T A 10: 116,839,353 N225I possibly damaging Het
Naaladl2 A C 3: 24,413,348 probably null Het
Ndrg1 C T 15: 66,948,394 D64N probably damaging Het
Olfr1057 A G 2: 86,375,181 I77T probably damaging Het
Olfr820 T C 10: 130,017,534 Y58H probably damaging Het
Rasa3 A C 8: 13,588,015 L343R probably benign Het
Ros1 T G 10: 52,163,971 K308T probably damaging Het
Rp1l1 A G 14: 64,029,803 Y946C probably benign Het
Rpl13a A T 7: 45,126,173 L156Q probably damaging Het
Samd9l A G 6: 3,375,975 F429L possibly damaging Het
Slc25a25 A G 2: 32,451,209 V39A probably benign Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Sspo G A 6: 48,475,371 W2756* probably null Het
Sult6b2 T A 6: 142,786,359 N274I probably benign Het
Tbc1d14 G A 5: 36,495,038 R667W probably damaging Het
Tg T C 15: 66,715,163 S1597P probably damaging Het
Thy1 A G 9: 44,047,435 D158G probably damaging Het
Tns4 T C 11: 99,071,470 Y567C probably damaging Het
Vmn1r170 A G 7: 23,607,048 R292G probably damaging Het
Vmn2r120 C A 17: 57,536,657 R62S probably benign Het
Vmn2r88 T G 14: 51,417,989 C552G Het
Xpo4 T A 14: 57,589,959 I927F probably damaging Het
Zc3h7a A T 16: 11,139,026 C906* probably null Het
Zdhhc22 T C 12: 86,983,388 D262G probably benign Het
Zfc3h1 C T 10: 115,410,701 Q898* probably null Het
Zfp280d T A 9: 72,301,965 S126T probably damaging Het
Zfp652 G T 11: 95,749,718 E156D probably benign Het
Zfp74 T C 7: 29,935,183 R367G probably damaging Het
Other mutations in Chl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Chl1 APN 6 103693061 missense probably benign 0.08
IGL00786:Chl1 APN 6 103675145 missense probably damaging 1.00
IGL00959:Chl1 APN 6 103709250 splice site probably null
IGL01109:Chl1 APN 6 103715393 missense probably damaging 1.00
IGL01354:Chl1 APN 6 103665853 missense probably benign 0.01
IGL01367:Chl1 APN 6 103729225 missense probably benign 0.42
IGL01371:Chl1 APN 6 103715364 missense probably damaging 1.00
IGL01599:Chl1 APN 6 103708484 missense probably benign 0.34
IGL01724:Chl1 APN 6 103649573 missense probably damaging 1.00
IGL02001:Chl1 APN 6 103642056 missense possibly damaging 0.90
IGL02066:Chl1 APN 6 103698224 missense probably benign 0.39
IGL02122:Chl1 APN 6 103675137 missense probably benign 0.39
IGL02340:Chl1 APN 6 103698125 missense probably damaging 1.00
IGL02420:Chl1 APN 6 103715369 missense probably damaging 1.00
IGL02421:Chl1 APN 6 103717580 missense probably damaging 1.00
IGL02429:Chl1 APN 6 103664809 unclassified probably benign
IGL02825:Chl1 APN 6 103668803 missense possibly damaging 0.87
IGL02858:Chl1 APN 6 103641988 missense probably damaging 1.00
IGL03169:Chl1 APN 6 103665967 missense probably damaging 1.00
IGL03185:Chl1 APN 6 103665863 missense probably damaging 1.00
IGL03189:Chl1 APN 6 103683207 missense possibly damaging 0.91
IGL03288:Chl1 APN 6 103675097 missense probably damaging 1.00
IGL03404:Chl1 APN 6 103693091 missense probably damaging 1.00
IGL03052:Chl1 UTSW 6 103691667 missense probably benign 0.01
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0062:Chl1 UTSW 6 103749652 missense unknown
R0314:Chl1 UTSW 6 103647301 missense probably damaging 1.00
R0322:Chl1 UTSW 6 103701883 splice site probably benign
R0685:Chl1 UTSW 6 103708542 splice site probably null
R0702:Chl1 UTSW 6 103706622 missense probably damaging 1.00
R1056:Chl1 UTSW 6 103675077 missense possibly damaging 0.66
R1138:Chl1 UTSW 6 103693179 missense probably benign 0.05
R1483:Chl1 UTSW 6 103647287 missense probably damaging 1.00
R1571:Chl1 UTSW 6 103708484 missense probably benign 0.34
R1620:Chl1 UTSW 6 103690242 missense probably benign 0.00
R1645:Chl1 UTSW 6 103683180 missense probably benign 0.06
R1773:Chl1 UTSW 6 103647331 critical splice donor site probably null
R1852:Chl1 UTSW 6 103699159 splice site probably null
R1891:Chl1 UTSW 6 103714583 missense possibly damaging 0.88
R2146:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2147:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2148:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2163:Chl1 UTSW 6 103711231 missense probably damaging 1.00
R2291:Chl1 UTSW 6 103715393 missense probably damaging 1.00
R2920:Chl1 UTSW 6 103695343 missense probably damaging 1.00
R3611:Chl1 UTSW 6 103698155 missense probably damaging 1.00
R3979:Chl1 UTSW 6 103715284 nonsense probably null
R4987:Chl1 UTSW 6 103674977 missense probably damaging 1.00
R5266:Chl1 UTSW 6 103700543 missense probably damaging 1.00
R5478:Chl1 UTSW 6 103683221 missense probably damaging 1.00
R5523:Chl1 UTSW 6 103708714 missense probably damaging 1.00
R5887:Chl1 UTSW 6 103717604 missense probably benign 0.00
R5986:Chl1 UTSW 6 103709191 missense probably benign 0.45
R6101:Chl1 UTSW 6 103693032 missense probably damaging 0.96
R6179:Chl1 UTSW 6 103683243 missense probably benign 0.38
R6366:Chl1 UTSW 6 103729236 missense possibly damaging 0.95
R6634:Chl1 UTSW 6 103690259 missense probably damaging 1.00
R6824:Chl1 UTSW 6 103714549 missense probably damaging 1.00
R6913:Chl1 UTSW 6 103665948 nonsense probably null
R7097:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7122:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7198:Chl1 UTSW 6 103706556 missense probably damaging 1.00
R7203:Chl1 UTSW 6 103691674 missense probably benign 0.13
R7527:Chl1 UTSW 6 103711201 missense probably damaging 1.00
R7625:Chl1 UTSW 6 103729125 missense probably damaging 1.00
R7683:Chl1 UTSW 6 103691652 missense possibly damaging 0.72
R7712:Chl1 UTSW 6 103711102 missense possibly damaging 0.94
R7838:Chl1 UTSW 6 103691674 missense probably benign 0.01
R7863:Chl1 UTSW 6 103706514 missense possibly damaging 0.46
R7874:Chl1 UTSW 6 103690263 missense probably benign 0.22
R7998:Chl1 UTSW 6 103729289 missense probably benign 0.01
R8044:Chl1 UTSW 6 103706632 missense probably damaging 0.96
R8059:Chl1 UTSW 6 103674987 missense probably damaging 0.97
Z1177:Chl1 UTSW 6 103693096 nonsense probably null
Z1177:Chl1 UTSW 6 103697949 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGTGCTCTGTAGTTCTAATATC -3'
(R):5'- GTTTCCTGCACTGAGGAGAG -3'

Sequencing Primer
(F):5'- CTCCTAAGAATCCTCGAATCC -3'
(R):5'- TTTCCTGCACTGAGGAGAGAAACC -3'
Posted On2019-11-12