Incidental Mutation 'R0239:Olfr1126'
ID59198
Institutional Source Beutler Lab
Gene Symbol Olfr1126
Ensembl Gene ENSMUSG00000058194
Gene Nameolfactory receptor 1126
SynonymsGA_x6K02T2Q125-48959068-48960012, MOR264-5
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0239 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87453962-87458911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87458037 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 291 (F291L)
Ref Sequence ENSEMBL: ENSMUSP00000150504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071355] [ENSMUST00000213366]
Predicted Effect probably benign
Transcript: ENSMUST00000071355
AA Change: F291L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071313
Gene: ENSMUSG00000058194
AA Change: F291L

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 8.6e-52 PFAM
Pfam:7tm_1 47 296 8.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213366
AA Change: F291L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Greb1l C T 18: 10,458,567 probably benign Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Il4ra T C 7: 125,575,199 probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Klc1 A G 12: 111,785,324 probably benign Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Mfsd7a G T 5: 108,444,016 probably benign Het
Micu2 G A 14: 57,917,378 probably benign Het
Mrrf T C 2: 36,177,281 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Pzp C T 6: 128,489,156 probably benign Het
Raet1c C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Scgb1b2 T A 7: 31,291,730 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Olfr1126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1126 APN 2 87457927 missense probably damaging 1.00
IGL01875:Olfr1126 APN 2 87457310 missense probably damaging 0.99
IGL02207:Olfr1126 APN 2 87457450 missense probably benign 0.22
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0239:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0478:Olfr1126 UTSW 2 87458026 missense probably damaging 0.99
R1055:Olfr1126 UTSW 2 87457437 small deletion probably benign
R1438:Olfr1126 UTSW 2 87457992 missense probably benign 0.00
R1625:Olfr1126 UTSW 2 87457672 missense probably damaging 1.00
R1912:Olfr1126 UTSW 2 87457383 missense probably damaging 1.00
R3052:Olfr1126 UTSW 2 87457903 missense probably damaging 1.00
R4638:Olfr1126 UTSW 2 87457983 missense possibly damaging 0.60
R5102:Olfr1126 UTSW 2 87457794 missense probably benign
R5526:Olfr1126 UTSW 2 87457765 missense probably benign 0.01
R5825:Olfr1126 UTSW 2 87457450 missense probably benign 0.22
R5965:Olfr1126 UTSW 2 87458037 missense probably benign 0.14
R6505:Olfr1126 UTSW 2 87457927 missense probably damaging 1.00
R7494:Olfr1126 UTSW 2 87457568 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCACCATTCTGAAGTTGCCAACA -3'
(R):5'- ACTGTGGTTCACACTGCACTTATTTGT -3'

Sequencing Primer
(F):5'- GTTGCCAACAGCCACAGG -3'
(R):5'- AGCTATCATTCAAAATGGCACAG -3'
Posted On2013-07-11