Incidental Mutation 'R7667:Zfp74'
ID591983
Institutional Source Beutler Lab
Gene Symbol Zfp74
Ensembl Gene ENSMUSG00000059975
Gene Namezinc finger protein 74
SynonymsKRAB8, 2810054M15Rik, Zfp66
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7667 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29930815-29954089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29935183 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 367 (R367G)
Ref Sequence ENSEMBL: ENSMUSP00000103840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032797] [ENSMUST00000108205] [ENSMUST00000108211] [ENSMUST00000108212]
Predicted Effect probably damaging
Transcript: ENSMUST00000032797
AA Change: R367G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032797
Gene: ENSMUSG00000059975
AA Change: R367G

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
ZnF_C2H2 179 201 1.84e-4 SMART
ZnF_C2H2 207 229 2.36e-2 SMART
ZnF_C2H2 235 257 1.5e-4 SMART
ZnF_C2H2 263 285 2.79e-4 SMART
ZnF_C2H2 291 313 3.49e-5 SMART
ZnF_C2H2 319 341 6.42e-4 SMART
ZnF_C2H2 347 369 5.59e-4 SMART
ZnF_C2H2 375 397 5.21e-4 SMART
ZnF_C2H2 403 425 3.63e-3 SMART
ZnF_C2H2 431 453 1.82e-3 SMART
ZnF_C2H2 459 481 1.58e-3 SMART
ZnF_C2H2 487 509 2.12e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.24e-3 SMART
ZnF_C2H2 571 593 8.02e-5 SMART
ZnF_C2H2 599 621 1.04e-3 SMART
ZnF_C2H2 627 649 1.04e-3 SMART
ZnF_C2H2 655 677 9.88e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108205
AA Change: R367G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103840
Gene: ENSMUSG00000059975
AA Change: R367G

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
ZnF_C2H2 179 201 1.84e-4 SMART
ZnF_C2H2 207 229 2.36e-2 SMART
ZnF_C2H2 235 257 1.5e-4 SMART
ZnF_C2H2 263 285 2.79e-4 SMART
ZnF_C2H2 291 313 3.49e-5 SMART
ZnF_C2H2 319 341 6.42e-4 SMART
ZnF_C2H2 347 369 5.59e-4 SMART
ZnF_C2H2 375 397 5.21e-4 SMART
ZnF_C2H2 403 425 3.63e-3 SMART
ZnF_C2H2 431 453 1.82e-3 SMART
ZnF_C2H2 459 481 1.58e-3 SMART
ZnF_C2H2 487 509 2.12e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.24e-3 SMART
ZnF_C2H2 571 593 8.02e-5 SMART
ZnF_C2H2 599 621 1.04e-3 SMART
ZnF_C2H2 627 649 1.04e-3 SMART
ZnF_C2H2 655 677 9.88e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108211
SMART Domains Protein: ENSMUSP00000103846
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108212
SMART Domains Protein: ENSMUSP00000103847
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,333,952 probably null Het
Adgrf5 A C 17: 43,446,039 I675L probably benign Het
Arhgap24 T A 5: 102,878,457 M248K probably benign Het
Chl1 G A 6: 103,695,495 D566N possibly damaging Het
Cntn4 A T 6: 106,679,895 I908F possibly damaging Het
Cyld T C 8: 88,742,302 I752T probably benign Het
Cyp26a1 C A 19: 37,700,624 L336I possibly damaging Het
Dmkn G A 7: 30,777,609 G446D probably damaging Het
Dnajc25 T C 4: 59,020,356 Y260H probably damaging Het
Dnm3 C A 1: 162,011,830 R186L probably damaging Het
Dst C T 1: 34,179,035 H1519Y possibly damaging Het
Eif1ad A G 19: 5,368,215 H9R probably damaging Het
Epha3 A T 16: 63,566,600 I891N probably benign Het
Epx T C 11: 87,874,311 T187A probably damaging Het
Fbln2 T G 6: 91,233,667 Y198D probably damaging Het
Fhod3 A G 18: 25,001,944 I371V probably benign Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gm4922 C T 10: 18,784,348 V209I probably damaging Het
Gucy1a2 G A 9: 3,759,580 G462D probably damaging Het
Gzmd T C 14: 56,131,252 T62A probably damaging Het
Hnrnpul1 A T 7: 25,754,421 L72Q probably damaging Het
Ifi211 A T 1: 173,899,454 W375R probably damaging Het
Il1rl2 C A 1: 40,365,253 H511Q probably damaging Het
Kcnn2 A T 18: 45,559,438 H27L possibly damaging Het
Kng2 A G 16: 22,988,232 Y406H probably damaging Het
Lama1 A G 17: 67,780,597 E1491G Het
Lmf1 T C 17: 25,654,608 probably null Het
Med24 T C 11: 98,713,164 N417S possibly damaging Het
Mfsd4b5 T C 10: 39,974,800 E60G probably benign Het
Myo7b A G 18: 31,961,905 V1879A probably benign Het
Myrfl T A 10: 116,839,353 N225I possibly damaging Het
Naaladl2 A C 3: 24,413,348 probably null Het
Ndrg1 C T 15: 66,948,394 D64N probably damaging Het
Olfr1057 A G 2: 86,375,181 I77T probably damaging Het
Olfr820 T C 10: 130,017,534 Y58H probably damaging Het
Rasa3 A C 8: 13,588,015 L343R probably benign Het
Ros1 T G 10: 52,163,971 K308T probably damaging Het
Rp1l1 A G 14: 64,029,803 Y946C probably benign Het
Rpl13a A T 7: 45,126,173 L156Q probably damaging Het
Samd9l A G 6: 3,375,975 F429L possibly damaging Het
Slc25a25 A G 2: 32,451,209 V39A probably benign Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Sspo G A 6: 48,475,371 W2756* probably null Het
Sult6b2 T A 6: 142,786,359 N274I probably benign Het
Tbc1d14 G A 5: 36,495,038 R667W probably damaging Het
Tg T C 15: 66,715,163 S1597P probably damaging Het
Thy1 A G 9: 44,047,435 D158G probably damaging Het
Tns4 T C 11: 99,071,470 Y567C probably damaging Het
Vmn1r170 A G 7: 23,607,048 R292G probably damaging Het
Vmn2r120 C A 17: 57,536,657 R62S probably benign Het
Vmn2r88 T G 14: 51,417,989 C552G Het
Xpo4 T A 14: 57,589,959 I927F probably damaging Het
Zc3h7a A T 16: 11,139,026 C906* probably null Het
Zdhhc22 T C 12: 86,983,388 D262G probably benign Het
Zfc3h1 C T 10: 115,410,701 Q898* probably null Het
Zfp280d T A 9: 72,301,965 S126T probably damaging Het
Zfp652 G T 11: 95,749,718 E156D probably benign Het
Other mutations in Zfp74
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Zfp74 UTSW 7 29954041 start gained probably benign
R0387:Zfp74 UTSW 7 29934754 missense probably benign 0.05
R0948:Zfp74 UTSW 7 29935937 critical splice donor site probably null
R1757:Zfp74 UTSW 7 29935061 missense probably benign 0.01
R1813:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1893:Zfp74 UTSW 7 29936045 critical splice acceptor site probably null
R1896:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1958:Zfp74 UTSW 7 29935711 missense probably benign 0.08
R2092:Zfp74 UTSW 7 29953924 start gained probably benign
R2111:Zfp74 UTSW 7 29935018 nonsense probably null
R4894:Zfp74 UTSW 7 29936045 critical splice acceptor site probably benign
R5121:Zfp74 UTSW 7 29932507 intron probably null
R5123:Zfp74 UTSW 7 29934733 missense probably damaging 1.00
R5129:Zfp74 UTSW 7 29932455 missense probably benign 0.00
R5213:Zfp74 UTSW 7 29935243 missense probably damaging 1.00
R5460:Zfp74 UTSW 7 29935891 missense probably benign 0.04
R5519:Zfp74 UTSW 7 29935134 missense probably damaging 0.99
R5589:Zfp74 UTSW 7 29934565 missense probably damaging 1.00
R6287:Zfp74 UTSW 7 29935776 missense probably benign
R6330:Zfp74 UTSW 7 29937987 missense probably damaging 1.00
R6370:Zfp74 UTSW 7 29932410 missense probably damaging 0.96
R6407:Zfp74 UTSW 7 29935623 missense probably damaging 1.00
R6694:Zfp74 UTSW 7 29935134 missense probably damaging 0.99
R6791:Zfp74 UTSW 7 29934435 missense probably benign 0.02
R7144:Zfp74 UTSW 7 29935165 missense probably damaging 0.98
R7662:Zfp74 UTSW 7 29953853 critical splice donor site probably null
R7898:Zfp74 UTSW 7 29935955 nonsense probably null
R7981:Zfp74 UTSW 7 29935955 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCACACTCATTGCATCCGTA -3'
(R):5'- GCGAGTGCGGGAAGACTTT -3'

Sequencing Primer
(F):5'- CGTAAGGTTTCTCTCGAGTATGG -3'
(R):5'- AATGTGGGAAATCCTTCGGCC -3'
Posted On2019-11-12