Incidental Mutation 'R7667:Rasa3'
ID 591986
Institutional Source Beutler Lab
Gene Symbol Rasa3
Ensembl Gene ENSMUSG00000031453
Gene Name RAS p21 protein activator 3
Synonyms GAPIII activator 3, Ras GTPase-activating protein III, scat, hlb381, GAPIII, R-Ras gap
MMRRC Submission 045740-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7667 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 13617218-13727590 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 13638015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 343 (L343R)
Ref Sequence ENSEMBL: ENSMUSP00000112998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117551]
AlphaFold Q60790
Predicted Effect probably benign
Transcript: ENSMUST00000117551
AA Change: L343R

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: L343R

DomainStartEndE-ValueType
C2 13 111 2.29e-15 SMART
C2 146 262 1.03e-17 SMART
RasGAP 275 614 3.96e-166 SMART
PH 577 679 5.53e-16 SMART
BTK 679 715 9.16e-19 SMART
Meta Mutation Damage Score 0.6846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,383,953 (GRCm39) probably null Het
Adgrf5 A C 17: 43,756,930 (GRCm39) I675L probably benign Het
Arhgap24 T A 5: 103,026,323 (GRCm39) M248K probably benign Het
Chl1 G A 6: 103,672,456 (GRCm39) D566N possibly damaging Het
Cntn4 A T 6: 106,656,856 (GRCm39) I908F possibly damaging Het
Cyld T C 8: 89,468,930 (GRCm39) I752T probably benign Het
Cyp26a1 C A 19: 37,689,072 (GRCm39) L336I possibly damaging Het
Dlg2 A G 7: 92,087,364 (GRCm39) probably null Het
Dmkn G A 7: 30,477,034 (GRCm39) G446D probably damaging Het
Dnajc25 T C 4: 59,020,356 (GRCm39) Y260H probably damaging Het
Dnm3 C A 1: 161,839,399 (GRCm39) R186L probably damaging Het
Dst C T 1: 34,218,116 (GRCm39) H1519Y possibly damaging Het
Efcab3 C T 11: 104,642,737 (GRCm39) T1120I possibly damaging Het
Eif1ad A G 19: 5,418,243 (GRCm39) H9R probably damaging Het
Epha3 A T 16: 63,386,963 (GRCm39) I891N probably benign Het
Epx T C 11: 87,765,137 (GRCm39) T187A probably damaging Het
Fbln2 T G 6: 91,210,649 (GRCm39) Y198D probably damaging Het
Fhod3 A G 18: 25,135,001 (GRCm39) I371V probably benign Het
Gm4922 C T 10: 18,660,096 (GRCm39) V209I probably damaging Het
Gucy1a2 G A 9: 3,759,580 (GRCm39) G462D probably damaging Het
Gzmd T C 14: 56,368,709 (GRCm39) T62A probably damaging Het
Hnrnpul1 A T 7: 25,453,846 (GRCm39) L72Q probably damaging Het
Ifi211 A T 1: 173,727,020 (GRCm39) W375R probably damaging Het
Il1rl2 C A 1: 40,404,413 (GRCm39) H511Q probably damaging Het
Kcnn2 A T 18: 45,692,505 (GRCm39) H27L possibly damaging Het
Kng2 A G 16: 22,806,982 (GRCm39) Y406H probably damaging Het
Lama1 A G 17: 68,087,592 (GRCm39) E1491G Het
Lmf1 T C 17: 25,873,582 (GRCm39) probably null Het
Med24 T C 11: 98,603,990 (GRCm39) N417S possibly damaging Het
Mfsd4b5 T C 10: 39,850,796 (GRCm39) E60G probably benign Het
Myo7b A G 18: 32,094,958 (GRCm39) V1879A probably benign Het
Myrfl T A 10: 116,675,258 (GRCm39) N225I possibly damaging Het
Naaladl2 A C 3: 24,467,512 (GRCm39) probably null Het
Ndrg1 C T 15: 66,820,243 (GRCm39) D64N probably damaging Het
Or6c33 T C 10: 129,853,403 (GRCm39) Y58H probably damaging Het
Or8j3b A G 2: 86,205,525 (GRCm39) I77T probably damaging Het
Ros1 T G 10: 52,040,067 (GRCm39) K308T probably damaging Het
Rp1l1 A G 14: 64,267,252 (GRCm39) Y946C probably benign Het
Rpl13a A T 7: 44,775,597 (GRCm39) L156Q probably damaging Het
Samd9l A G 6: 3,375,975 (GRCm39) F429L possibly damaging Het
Slc25a25 A G 2: 32,341,221 (GRCm39) V39A probably benign Het
Snrnp27 A T 6: 86,657,935 (GRCm39) I101K possibly damaging Het
Sspo G A 6: 48,452,305 (GRCm39) W2756* probably null Het
Sult6b2 T A 6: 142,732,085 (GRCm39) N274I probably benign Het
Tbc1d14 G A 5: 36,652,382 (GRCm39) R667W probably damaging Het
Tg T C 15: 66,587,012 (GRCm39) S1597P probably damaging Het
Thy1 A G 9: 43,958,732 (GRCm39) D158G probably damaging Het
Tns4 T C 11: 98,962,296 (GRCm39) Y567C probably damaging Het
Vmn1r170 A G 7: 23,306,473 (GRCm39) R292G probably damaging Het
Vmn2r120 C A 17: 57,843,657 (GRCm39) R62S probably benign Het
Vmn2r88 T G 14: 51,655,446 (GRCm39) C552G Het
Xpo4 T A 14: 57,827,416 (GRCm39) I927F probably damaging Het
Zc3h7a A T 16: 10,956,890 (GRCm39) C906* probably null Het
Zdhhc22 T C 12: 87,030,162 (GRCm39) D262G probably benign Het
Zfc3h1 C T 10: 115,246,606 (GRCm39) Q898* probably null Het
Zfp280d T A 9: 72,209,247 (GRCm39) S126T probably damaging Het
Zfp652 G T 11: 95,640,544 (GRCm39) E156D probably benign Het
Zfp74 T C 7: 29,634,608 (GRCm39) R367G probably damaging Het
Other mutations in Rasa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Rasa3 APN 8 13,645,410 (GRCm39) unclassified probably benign
IGL02112:Rasa3 APN 8 13,635,042 (GRCm39) splice site probably benign
IGL02946:Rasa3 APN 8 13,648,280 (GRCm39) missense probably benign 0.33
IGL03085:Rasa3 APN 8 13,635,690 (GRCm39) missense probably benign 0.11
Box_canyon UTSW 8 13,634,959 (GRCm39) nonsense probably null
Erasor UTSW 8 13,636,873 (GRCm39) critical splice donor site probably null
koko_head UTSW 8 13,664,605 (GRCm39) missense possibly damaging 0.70
Mount_ouray UTSW 8 13,681,811 (GRCm39) missense possibly damaging 0.90
Poncha_pass UTSW 8 13,645,373 (GRCm39) missense possibly damaging 0.46
Tabula UTSW 8 13,635,029 (GRCm39) missense probably damaging 1.00
Ute UTSW 8 13,632,381 (GRCm39) splice site probably benign
PIT4531001:Rasa3 UTSW 8 13,655,887 (GRCm39) missense probably benign 0.11
R0193:Rasa3 UTSW 8 13,620,233 (GRCm39) splice site probably null
R0710:Rasa3 UTSW 8 13,633,830 (GRCm39) missense probably damaging 1.00
R0726:Rasa3 UTSW 8 13,630,118 (GRCm39) splice site probably benign
R1405:Rasa3 UTSW 8 13,638,027 (GRCm39) missense possibly damaging 0.83
R1405:Rasa3 UTSW 8 13,638,027 (GRCm39) missense possibly damaging 0.83
R1797:Rasa3 UTSW 8 13,632,372 (GRCm39) missense probably benign 0.44
R1828:Rasa3 UTSW 8 13,635,035 (GRCm39) missense probably benign 0.02
R1895:Rasa3 UTSW 8 13,681,768 (GRCm39) splice site probably benign
R2090:Rasa3 UTSW 8 13,632,381 (GRCm39) splice site probably benign
R2374:Rasa3 UTSW 8 13,627,411 (GRCm39) missense probably damaging 1.00
R2655:Rasa3 UTSW 8 13,645,373 (GRCm39) missense possibly damaging 0.46
R3703:Rasa3 UTSW 8 13,638,972 (GRCm39) missense probably benign
R3899:Rasa3 UTSW 8 13,628,635 (GRCm39) missense probably benign 0.21
R4230:Rasa3 UTSW 8 13,620,264 (GRCm39) missense possibly damaging 0.47
R4256:Rasa3 UTSW 8 13,664,532 (GRCm39) critical splice donor site probably null
R4281:Rasa3 UTSW 8 13,638,946 (GRCm39) missense probably benign 0.01
R4498:Rasa3 UTSW 8 13,664,587 (GRCm39) missense probably benign 0.01
R4558:Rasa3 UTSW 8 13,648,259 (GRCm39) missense probably damaging 0.96
R4559:Rasa3 UTSW 8 13,648,259 (GRCm39) missense probably damaging 0.96
R4647:Rasa3 UTSW 8 13,638,865 (GRCm39) missense probably null 0.00
R4702:Rasa3 UTSW 8 13,620,394 (GRCm39) missense probably benign 0.09
R4772:Rasa3 UTSW 8 13,648,289 (GRCm39) missense probably damaging 1.00
R4774:Rasa3 UTSW 8 13,627,501 (GRCm39) missense probably benign 0.07
R4807:Rasa3 UTSW 8 13,664,633 (GRCm39) missense probably damaging 1.00
R5008:Rasa3 UTSW 8 13,634,959 (GRCm39) nonsense probably null
R5043:Rasa3 UTSW 8 13,620,368 (GRCm39) missense possibly damaging 0.59
R5352:Rasa3 UTSW 8 13,681,778 (GRCm39) missense possibly damaging 0.88
R5435:Rasa3 UTSW 8 13,681,811 (GRCm39) missense possibly damaging 0.90
R6207:Rasa3 UTSW 8 13,648,251 (GRCm39) missense possibly damaging 0.67
R6733:Rasa3 UTSW 8 13,630,037 (GRCm39) missense possibly damaging 0.88
R6855:Rasa3 UTSW 8 13,635,029 (GRCm39) missense probably damaging 1.00
R7024:Rasa3 UTSW 8 13,681,826 (GRCm39) missense probably benign 0.29
R7100:Rasa3 UTSW 8 13,636,897 (GRCm39) missense probably benign 0.02
R7322:Rasa3 UTSW 8 13,645,857 (GRCm39) missense possibly damaging 0.46
R7394:Rasa3 UTSW 8 13,645,353 (GRCm39) missense probably benign 0.03
R7478:Rasa3 UTSW 8 13,664,605 (GRCm39) missense possibly damaging 0.70
R7486:Rasa3 UTSW 8 13,640,201 (GRCm39) critical splice donor site probably null
R7554:Rasa3 UTSW 8 13,645,390 (GRCm39) missense probably damaging 0.99
R7575:Rasa3 UTSW 8 13,645,887 (GRCm39) missense possibly damaging 0.73
R7641:Rasa3 UTSW 8 13,634,961 (GRCm39) missense probably benign 0.11
R7751:Rasa3 UTSW 8 13,618,708 (GRCm39) missense probably benign 0.18
R7999:Rasa3 UTSW 8 13,681,805 (GRCm39) missense probably benign 0.04
R8039:Rasa3 UTSW 8 13,638,931 (GRCm39) missense probably damaging 1.00
R8125:Rasa3 UTSW 8 13,627,801 (GRCm39) splice site probably null
R8514:Rasa3 UTSW 8 13,631,322 (GRCm39) missense probably benign 0.02
R8726:Rasa3 UTSW 8 13,626,381 (GRCm39) missense probably benign 0.00
R8728:Rasa3 UTSW 8 13,636,873 (GRCm39) critical splice donor site probably null
R8790:Rasa3 UTSW 8 13,727,391 (GRCm39) critical splice donor site probably null
R9036:Rasa3 UTSW 8 13,645,851 (GRCm39) missense probably benign 0.06
R9483:Rasa3 UTSW 8 13,630,033 (GRCm39) critical splice donor site probably null
R9602:Rasa3 UTSW 8 13,681,844 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATGGGATGAGCATGAGGT -3'
(R):5'- CTACAGGTTGGCCTCCCTGT -3'

Sequencing Primer
(F):5'- CATGAGGTAGAAGGGGCTTG -3'
(R):5'- GTGAAGGTCTGGAGTCACC -3'
Posted On 2019-11-12