Incidental Mutation 'R7667:Epx'
ID591997
Institutional Source Beutler Lab
Gene Symbol Epx
Ensembl Gene ENSMUSG00000052234
Gene Nameeosinophil peroxidase
SynonymsEPO
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7667 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87864000-87875536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87874311 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000050497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049768]
Predicted Effect probably damaging
Transcript: ENSMUST00000049768
AA Change: T187A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050497
Gene: ENSMUSG00000052234
AA Change: T187A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 146 690 8.3e-184 PFAM
Meta Mutation Damage Score 0.2271 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the peroxidase superfamily of enzymes that is produced by eosinophils and plays a critical role in eliminating tissue-invasive parasites. The encoded preproprotein undergoes proteolytic processing to generate a heterodimeric enzyme that forms a predominant component of the intracellular granules of eosinophils. Mice lacking the encoded protein exhibit resistance to ulcerative colitis induced by dextran sulfate. [provided by RefSeq, Jul 2016]
PHENOTYPE: Targeted deletion of this gene results in ultrastructural changes of the eosinophil secondary granule but does not significantly alter the course of inflammation or development of allergic pulmonary pathologies in an ovalbumin-challenge model of pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,333,952 probably null Het
Adgrf5 A C 17: 43,446,039 I675L probably benign Het
Arhgap24 T A 5: 102,878,457 M248K probably benign Het
Chl1 G A 6: 103,695,495 D566N possibly damaging Het
Cntn4 A T 6: 106,679,895 I908F possibly damaging Het
Cyld T C 8: 88,742,302 I752T probably benign Het
Cyp26a1 C A 19: 37,700,624 L336I possibly damaging Het
Dlg2 A G 7: 92,438,156 probably null Het
Dmkn G A 7: 30,777,609 G446D probably damaging Het
Dnajc25 T C 4: 59,020,356 Y260H probably damaging Het
Dnm3 C A 1: 162,011,830 R186L probably damaging Het
Dst C T 1: 34,179,035 H1519Y possibly damaging Het
Eif1ad A G 19: 5,368,215 H9R probably damaging Het
Epha3 A T 16: 63,566,600 I891N probably benign Het
Fbln2 T G 6: 91,233,667 Y198D probably damaging Het
Fhod3 A G 18: 25,001,944 I371V probably benign Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gm4922 C T 10: 18,784,348 V209I probably damaging Het
Gucy1a2 G A 9: 3,759,580 G462D probably damaging Het
Gzmd T C 14: 56,131,252 T62A probably damaging Het
Hnrnpul1 A T 7: 25,754,421 L72Q probably damaging Het
Ifi211 A T 1: 173,899,454 W375R probably damaging Het
Il1rl2 C A 1: 40,365,253 H511Q probably damaging Het
Kcnn2 A T 18: 45,559,438 H27L possibly damaging Het
Kng2 A G 16: 22,988,232 Y406H probably damaging Het
Lama1 A G 17: 67,780,597 E1491G Het
Lmf1 T C 17: 25,654,608 probably null Het
Med24 T C 11: 98,713,164 N417S possibly damaging Het
Mfsd4b5 T C 10: 39,974,800 E60G probably benign Het
Myo7b A G 18: 31,961,905 V1879A probably benign Het
Myrfl T A 10: 116,839,353 N225I possibly damaging Het
Naaladl2 A C 3: 24,413,348 probably null Het
Ndrg1 C T 15: 66,948,394 D64N probably damaging Het
Olfr1057 A G 2: 86,375,181 I77T probably damaging Het
Olfr820 T C 10: 130,017,534 Y58H probably damaging Het
Rasa3 A C 8: 13,588,015 L343R probably benign Het
Ros1 T G 10: 52,163,971 K308T probably damaging Het
Rp1l1 A G 14: 64,029,803 Y946C probably benign Het
Rpl13a A T 7: 45,126,173 L156Q probably damaging Het
Samd9l A G 6: 3,375,975 F429L possibly damaging Het
Slc25a25 A G 2: 32,451,209 V39A probably benign Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Sspo G A 6: 48,475,371 W2756* probably null Het
Sult6b2 T A 6: 142,786,359 N274I probably benign Het
Tbc1d14 G A 5: 36,495,038 R667W probably damaging Het
Tg T C 15: 66,715,163 S1597P probably damaging Het
Thy1 A G 9: 44,047,435 D158G probably damaging Het
Tns4 T C 11: 99,071,470 Y567C probably damaging Het
Vmn1r170 A G 7: 23,607,048 R292G probably damaging Het
Vmn2r120 C A 17: 57,536,657 R62S probably benign Het
Vmn2r88 T G 14: 51,417,989 C552G Het
Xpo4 T A 14: 57,589,959 I927F probably damaging Het
Zc3h7a A T 16: 11,139,026 C906* probably null Het
Zdhhc22 T C 12: 86,983,388 D262G probably benign Het
Zfc3h1 C T 10: 115,410,701 Q898* probably null Het
Zfp280d T A 9: 72,301,965 S126T probably damaging Het
Zfp652 G T 11: 95,749,718 E156D probably benign Het
Zfp74 T C 7: 29,935,183 R367G probably damaging Het
Other mutations in Epx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Epx APN 11 87869925 missense probably damaging 1.00
IGL01723:Epx APN 11 87869402 missense probably damaging 1.00
IGL02096:Epx APN 11 87869468 missense probably damaging 1.00
IGL02423:Epx APN 11 87871318 missense possibly damaging 0.85
K7371:Epx UTSW 11 87864884 missense probably damaging 1.00
R1018:Epx UTSW 11 87869303 missense probably benign 0.05
R1607:Epx UTSW 11 87868712 missense probably damaging 1.00
R2017:Epx UTSW 11 87874337 missense probably damaging 1.00
R2030:Epx UTSW 11 87864824 missense probably damaging 1.00
R3838:Epx UTSW 11 87874830 missense probably damaging 1.00
R4417:Epx UTSW 11 87869430 nonsense probably null
R5083:Epx UTSW 11 87872680 missense probably damaging 0.99
R5712:Epx UTSW 11 87874853 nonsense probably null
R5935:Epx UTSW 11 87865492 missense probably damaging 1.00
R6830:Epx UTSW 11 87868626 missense probably damaging 1.00
R6857:Epx UTSW 11 87869955 nonsense probably null
R6984:Epx UTSW 11 87868598 missense probably damaging 1.00
R7031:Epx UTSW 11 87875523 start gained probably benign
R7652:Epx UTSW 11 87875334 critical splice donor site probably null
R7969:Epx UTSW 11 87872721 missense probably benign 0.01
R8313:Epx UTSW 11 87872731 missense possibly damaging 0.71
R8559:Epx UTSW 11 87864792 missense probably damaging 0.99
X0065:Epx UTSW 11 87865475 missense probably benign 0.03
Z1177:Epx UTSW 11 87869261 missense probably damaging 1.00
Z1177:Epx UTSW 11 87869894 missense possibly damaging 0.56
Z1177:Epx UTSW 11 87872767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCAAGAACTTCACTTTCATTCAC -3'
(R):5'- ACAAGTGAGTGTTGGGACC -3'

Sequencing Primer
(F):5'- TTCACAGGTGAAGAAACTGGTCTC -3'
(R):5'- TGTTGGGACCCTGCCTCTG -3'
Posted On2019-11-12