Incidental Mutation 'R7667:Vmn2r88'
ID 592004
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Name vomeronasal 2, receptor 88
Synonyms V2r3, V2r13
MMRRC Submission 045740-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R7667 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 51410819-51419527 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 51417989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 552 (C552G)
Ref Sequence ENSEMBL: ENSMUSP00000125126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
AlphaFold L7N1W8
Predicted Effect probably damaging
Transcript: ENSMUST00000022438
AA Change: C561G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: C561G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: C552G

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: S411R

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228139
AA Change: C553G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,333,952 probably null Het
Adgrf5 A C 17: 43,446,039 I675L probably benign Het
Arhgap24 T A 5: 102,878,457 M248K probably benign Het
Chl1 G A 6: 103,695,495 D566N possibly damaging Het
Cntn4 A T 6: 106,679,895 I908F possibly damaging Het
Cyld T C 8: 88,742,302 I752T probably benign Het
Cyp26a1 C A 19: 37,700,624 L336I possibly damaging Het
Dlg2 A G 7: 92,438,156 probably null Het
Dmkn G A 7: 30,777,609 G446D probably damaging Het
Dnajc25 T C 4: 59,020,356 Y260H probably damaging Het
Dnm3 C A 1: 162,011,830 R186L probably damaging Het
Dst C T 1: 34,179,035 H1519Y possibly damaging Het
Eif1ad A G 19: 5,368,215 H9R probably damaging Het
Epha3 A T 16: 63,566,600 I891N probably benign Het
Epx T C 11: 87,874,311 T187A probably damaging Het
Fbln2 T G 6: 91,233,667 Y198D probably damaging Het
Fhod3 A G 18: 25,001,944 I371V probably benign Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gm4922 C T 10: 18,784,348 V209I probably damaging Het
Gucy1a2 G A 9: 3,759,580 G462D probably damaging Het
Gzmd T C 14: 56,131,252 T62A probably damaging Het
Hnrnpul1 A T 7: 25,754,421 L72Q probably damaging Het
Ifi211 A T 1: 173,899,454 W375R probably damaging Het
Il1rl2 C A 1: 40,365,253 H511Q probably damaging Het
Kcnn2 A T 18: 45,559,438 H27L possibly damaging Het
Kng2 A G 16: 22,988,232 Y406H probably damaging Het
Lama1 A G 17: 67,780,597 E1491G Het
Lmf1 T C 17: 25,654,608 probably null Het
Med24 T C 11: 98,713,164 N417S possibly damaging Het
Mfsd4b5 T C 10: 39,974,800 E60G probably benign Het
Myo7b A G 18: 31,961,905 V1879A probably benign Het
Myrfl T A 10: 116,839,353 N225I possibly damaging Het
Naaladl2 A C 3: 24,413,348 probably null Het
Ndrg1 C T 15: 66,948,394 D64N probably damaging Het
Olfr1057 A G 2: 86,375,181 I77T probably damaging Het
Olfr820 T C 10: 130,017,534 Y58H probably damaging Het
Rasa3 A C 8: 13,588,015 L343R probably benign Het
Ros1 T G 10: 52,163,971 K308T probably damaging Het
Rp1l1 A G 14: 64,029,803 Y946C probably benign Het
Rpl13a A T 7: 45,126,173 L156Q probably damaging Het
Samd9l A G 6: 3,375,975 F429L possibly damaging Het
Slc25a25 A G 2: 32,451,209 V39A probably benign Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Sspo G A 6: 48,475,371 W2756* probably null Het
Sult6b2 T A 6: 142,786,359 N274I probably benign Het
Tbc1d14 G A 5: 36,495,038 R667W probably damaging Het
Tg T C 15: 66,715,163 S1597P probably damaging Het
Thy1 A G 9: 44,047,435 D158G probably damaging Het
Tns4 T C 11: 99,071,470 Y567C probably damaging Het
Vmn1r170 A G 7: 23,607,048 R292G probably damaging Het
Vmn2r120 C A 17: 57,536,657 R62S probably benign Het
Xpo4 T A 14: 57,589,959 I927F probably damaging Het
Zc3h7a A T 16: 11,139,026 C906* probably null Het
Zdhhc22 T C 12: 86,983,388 D262G probably benign Het
Zfc3h1 C T 10: 115,410,701 Q898* probably null Het
Zfp280d T A 9: 72,301,965 S126T probably damaging Het
Zfp652 G T 11: 95,749,718 E156D probably benign Het
Zfp74 T C 7: 29,935,183 R367G probably damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51414140 missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51414108 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51413289 nonsense probably null
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7104:Vmn2r88 UTSW 14 51413796 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7552:Vmn2r88 UTSW 14 51410858 splice site probably null
R7611:Vmn2r88 UTSW 14 51413997 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7882:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51413132 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
R8142:Vmn2r88 UTSW 14 51414107 missense
R8186:Vmn2r88 UTSW 14 51418700 missense
R8348:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51413073 missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51414066 missense
R8859:Vmn2r88 UTSW 14 51418806 missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51411136 missense
R8936:Vmn2r88 UTSW 14 51418526 missense possibly damaging 0.88
R9004:Vmn2r88 UTSW 14 51413167 missense
R9038:Vmn2r88 UTSW 14 51414033 missense
R9063:Vmn2r88 UTSW 14 51410872 start gained probably benign
R9311:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R9382:Vmn2r88 UTSW 14 51418740 missense
R9483:Vmn2r88 UTSW 14 51411184 missense
R9602:Vmn2r88 UTSW 14 51413732 missense
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Z1190:Vmn2r88 UTSW 14 51413201 missense
Predicted Primers PCR Primer
(F):5'- TGCATACTACCCATGTCTGTG -3'
(R):5'- GCCTTCACAATGGGAGTATCC -3'

Sequencing Primer
(F):5'- ACTACCCATGTCTGTGAATAGTGG -3'
(R):5'- CTTCACAATGGGAGTATCCTTGTAC -3'
Posted On 2019-11-12