Incidental Mutation 'R7667:Xpo4'
ID 592006
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Name exportin 4
Synonyms B430309A01Rik
MMRRC Submission 045740-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.722) question?
Stock # R7667 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 57814978-57902887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57827416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 927 (I927F)
Ref Sequence ENSEMBL: ENSMUSP00000133280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174545]
AlphaFold Q9ESJ0
Predicted Effect probably damaging
Transcript: ENSMUST00000089482
AA Change: I927F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: I927F

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174545
AA Change: I927F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: I927F

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,383,953 (GRCm39) probably null Het
Adgrf5 A C 17: 43,756,930 (GRCm39) I675L probably benign Het
Arhgap24 T A 5: 103,026,323 (GRCm39) M248K probably benign Het
Chl1 G A 6: 103,672,456 (GRCm39) D566N possibly damaging Het
Cntn4 A T 6: 106,656,856 (GRCm39) I908F possibly damaging Het
Cyld T C 8: 89,468,930 (GRCm39) I752T probably benign Het
Cyp26a1 C A 19: 37,689,072 (GRCm39) L336I possibly damaging Het
Dlg2 A G 7: 92,087,364 (GRCm39) probably null Het
Dmkn G A 7: 30,477,034 (GRCm39) G446D probably damaging Het
Dnajc25 T C 4: 59,020,356 (GRCm39) Y260H probably damaging Het
Dnm3 C A 1: 161,839,399 (GRCm39) R186L probably damaging Het
Dst C T 1: 34,218,116 (GRCm39) H1519Y possibly damaging Het
Efcab3 C T 11: 104,642,737 (GRCm39) T1120I possibly damaging Het
Eif1ad A G 19: 5,418,243 (GRCm39) H9R probably damaging Het
Epha3 A T 16: 63,386,963 (GRCm39) I891N probably benign Het
Epx T C 11: 87,765,137 (GRCm39) T187A probably damaging Het
Fbln2 T G 6: 91,210,649 (GRCm39) Y198D probably damaging Het
Fhod3 A G 18: 25,135,001 (GRCm39) I371V probably benign Het
Gm4922 C T 10: 18,660,096 (GRCm39) V209I probably damaging Het
Gucy1a2 G A 9: 3,759,580 (GRCm39) G462D probably damaging Het
Gzmd T C 14: 56,368,709 (GRCm39) T62A probably damaging Het
Hnrnpul1 A T 7: 25,453,846 (GRCm39) L72Q probably damaging Het
Ifi211 A T 1: 173,727,020 (GRCm39) W375R probably damaging Het
Il1rl2 C A 1: 40,404,413 (GRCm39) H511Q probably damaging Het
Kcnn2 A T 18: 45,692,505 (GRCm39) H27L possibly damaging Het
Kng2 A G 16: 22,806,982 (GRCm39) Y406H probably damaging Het
Lama1 A G 17: 68,087,592 (GRCm39) E1491G Het
Lmf1 T C 17: 25,873,582 (GRCm39) probably null Het
Med24 T C 11: 98,603,990 (GRCm39) N417S possibly damaging Het
Mfsd4b5 T C 10: 39,850,796 (GRCm39) E60G probably benign Het
Myo7b A G 18: 32,094,958 (GRCm39) V1879A probably benign Het
Myrfl T A 10: 116,675,258 (GRCm39) N225I possibly damaging Het
Naaladl2 A C 3: 24,467,512 (GRCm39) probably null Het
Ndrg1 C T 15: 66,820,243 (GRCm39) D64N probably damaging Het
Or6c33 T C 10: 129,853,403 (GRCm39) Y58H probably damaging Het
Or8j3b A G 2: 86,205,525 (GRCm39) I77T probably damaging Het
Rasa3 A C 8: 13,638,015 (GRCm39) L343R probably benign Het
Ros1 T G 10: 52,040,067 (GRCm39) K308T probably damaging Het
Rp1l1 A G 14: 64,267,252 (GRCm39) Y946C probably benign Het
Rpl13a A T 7: 44,775,597 (GRCm39) L156Q probably damaging Het
Samd9l A G 6: 3,375,975 (GRCm39) F429L possibly damaging Het
Slc25a25 A G 2: 32,341,221 (GRCm39) V39A probably benign Het
Snrnp27 A T 6: 86,657,935 (GRCm39) I101K possibly damaging Het
Sspo G A 6: 48,452,305 (GRCm39) W2756* probably null Het
Sult6b2 T A 6: 142,732,085 (GRCm39) N274I probably benign Het
Tbc1d14 G A 5: 36,652,382 (GRCm39) R667W probably damaging Het
Tg T C 15: 66,587,012 (GRCm39) S1597P probably damaging Het
Thy1 A G 9: 43,958,732 (GRCm39) D158G probably damaging Het
Tns4 T C 11: 98,962,296 (GRCm39) Y567C probably damaging Het
Vmn1r170 A G 7: 23,306,473 (GRCm39) R292G probably damaging Het
Vmn2r120 C A 17: 57,843,657 (GRCm39) R62S probably benign Het
Vmn2r88 T G 14: 51,655,446 (GRCm39) C552G Het
Zc3h7a A T 16: 10,956,890 (GRCm39) C906* probably null Het
Zdhhc22 T C 12: 87,030,162 (GRCm39) D262G probably benign Het
Zfc3h1 C T 10: 115,246,606 (GRCm39) Q898* probably null Het
Zfp280d T A 9: 72,209,247 (GRCm39) S126T probably damaging Het
Zfp652 G T 11: 95,640,544 (GRCm39) E156D probably benign Het
Zfp74 T C 7: 29,634,608 (GRCm39) R367G probably damaging Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57,841,855 (GRCm39) missense probably benign
IGL02537:Xpo4 APN 14 57,831,290 (GRCm39) missense probably benign
IGL02554:Xpo4 APN 14 57,827,545 (GRCm39) missense probably benign 0.00
IGL02826:Xpo4 APN 14 57,866,877 (GRCm39) missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57,855,685 (GRCm39) missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57,822,068 (GRCm39) missense probably null 0.98
R0245:Xpo4 UTSW 14 57,867,697 (GRCm39) missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57,850,731 (GRCm39) missense probably benign 0.07
R0606:Xpo4 UTSW 14 57,875,665 (GRCm39) unclassified probably benign
R0761:Xpo4 UTSW 14 57,850,840 (GRCm39) missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57,841,129 (GRCm39) missense probably benign
R1853:Xpo4 UTSW 14 57,823,364 (GRCm39) missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57,828,328 (GRCm39) missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57,824,101 (GRCm39) missense probably null 0.19
R2035:Xpo4 UTSW 14 57,823,383 (GRCm39) missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57,827,547 (GRCm39) missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57,866,960 (GRCm39) missense probably benign 0.00
R2937:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R2938:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R4066:Xpo4 UTSW 14 57,825,511 (GRCm39) missense probably benign 0.07
R4086:Xpo4 UTSW 14 57,880,490 (GRCm39) intron probably benign
R4373:Xpo4 UTSW 14 57,828,479 (GRCm39) nonsense probably null
R4620:Xpo4 UTSW 14 57,867,782 (GRCm39) missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57,827,565 (GRCm39) missense probably benign 0.01
R4755:Xpo4 UTSW 14 57,855,638 (GRCm39) missense probably benign 0.01
R4831:Xpo4 UTSW 14 57,827,559 (GRCm39) missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57,875,746 (GRCm39) missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57,875,697 (GRCm39) missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57,822,098 (GRCm39) missense probably benign 0.02
R5279:Xpo4 UTSW 14 57,850,866 (GRCm39) missense probably benign 0.37
R5375:Xpo4 UTSW 14 57,875,764 (GRCm39) missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57,828,446 (GRCm39) missense probably benign 0.03
R5936:Xpo4 UTSW 14 57,880,956 (GRCm39) missense probably benign
R6393:Xpo4 UTSW 14 57,875,770 (GRCm39) missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57,850,860 (GRCm39) missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57,819,767 (GRCm39) missense probably benign
R6923:Xpo4 UTSW 14 57,841,168 (GRCm39) missense probably benign 0.19
R7028:Xpo4 UTSW 14 57,834,508 (GRCm39) missense probably benign 0.22
R7442:Xpo4 UTSW 14 57,867,680 (GRCm39) missense probably benign 0.00
R7469:Xpo4 UTSW 14 57,835,436 (GRCm39) missense probably benign
R7490:Xpo4 UTSW 14 57,840,078 (GRCm39) frame shift probably null
R7622:Xpo4 UTSW 14 57,834,468 (GRCm39) missense possibly damaging 0.94
R7789:Xpo4 UTSW 14 57,850,806 (GRCm39) missense probably benign 0.00
R7895:Xpo4 UTSW 14 57,840,048 (GRCm39) missense probably benign 0.03
R8000:Xpo4 UTSW 14 57,827,403 (GRCm39) missense probably damaging 1.00
R8372:Xpo4 UTSW 14 57,835,341 (GRCm39) critical splice donor site probably null
R8395:Xpo4 UTSW 14 57,885,924 (GRCm39) missense probably benign 0.01
R8420:Xpo4 UTSW 14 57,841,913 (GRCm39) missense probably damaging 0.99
R8836:Xpo4 UTSW 14 57,902,367 (GRCm39) missense probably benign 0.03
R8841:Xpo4 UTSW 14 57,835,413 (GRCm39) missense probably damaging 0.97
R8989:Xpo4 UTSW 14 57,828,475 (GRCm39) missense probably benign 0.00
R9229:Xpo4 UTSW 14 57,851,156 (GRCm39) missense probably benign
R9374:Xpo4 UTSW 14 57,828,512 (GRCm39) missense possibly damaging 0.94
R9551:Xpo4 UTSW 14 57,828,512 (GRCm39) missense possibly damaging 0.94
R9628:Xpo4 UTSW 14 57,842,630 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAAGAGAAAGGTCTTCATCTC -3'
(R):5'- TGACTCATCTACTAGATCCTACCAAG -3'

Sequencing Primer
(F):5'- ATCTCTACCTTCACTTCAGCTAAAG -3'
(R):5'- AAGTAATACCACTCCTCATGTTTTC -3'
Posted On 2019-11-12