Incidental Mutation 'R7667:Ndrg1'
ID592009
Institutional Source Beutler Lab
Gene Symbol Ndrg1
Ensembl Gene ENSMUSG00000005125
Gene NameN-myc downstream regulated gene 1
SynonymsTDD5, CMT4D, CAP43, DRG1, Tdd5, Ndr1, PROXY1, Ndrl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7667 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location66929318-66969640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66948394 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 64 (D64N)
Ref Sequence ENSEMBL: ENSMUSP00000005256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005256] [ENSMUST00000163496] [ENSMUST00000164070] [ENSMUST00000164675] [ENSMUST00000166420] [ENSMUST00000168542] [ENSMUST00000168979] [ENSMUST00000170903] [ENSMUST00000171266] [ENSMUST00000172447]
Predicted Effect probably damaging
Transcript: ENSMUST00000005256
AA Change: D64N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005256
Gene: ENSMUSG00000005125
AA Change: D64N

DomainStartEndE-ValueType
Pfam:Ndr 34 316 4.4e-130 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163496
AA Change: D64N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130584
Gene: ENSMUSG00000005125
AA Change: D64N

DomainStartEndE-ValueType
Pfam:Ndr 34 155 1.2e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164070
AA Change: D44N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126091
Gene: ENSMUSG00000005125
AA Change: D44N

DomainStartEndE-ValueType
Pfam:Ndr 18 53 8.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164675
Predicted Effect probably benign
Transcript: ENSMUST00000166420
SMART Domains Protein: ENSMUSP00000127099
Gene: ENSMUSG00000005125

DomainStartEndE-ValueType
Pfam:Ndr 17 132 1.4e-34 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000127075
Gene: ENSMUSG00000005125
AA Change: D29N

DomainStartEndE-ValueType
Pfam:Ndr 1 76 1.7e-35 PFAM
Pfam:Ndr 73 119 2.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168542
Predicted Effect probably damaging
Transcript: ENSMUST00000168979
AA Change: D64N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126985
Gene: ENSMUSG00000005125
AA Change: D64N

DomainStartEndE-ValueType
Pfam:Ndr 34 174 6.3e-72 PFAM
Pfam:Abhydrolase_6 53 173 5.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170903
AA Change: D64N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127302
Gene: ENSMUSG00000005125
AA Change: D64N

DomainStartEndE-ValueType
Pfam:Ndr 34 157 1.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171266
Predicted Effect probably benign
Transcript: ENSMUST00000172447
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous null mice exhibit a progressive demyelinating disorder of the peripheral nerves with hindlimb weakness. Mice homozygous for a different knock-out allele exhibit decreased cellular susceptibility to gamma-irradiation and increased susceptibility to spontaneous and induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,333,952 probably null Het
Adgrf5 A C 17: 43,446,039 I675L probably benign Het
Arhgap24 T A 5: 102,878,457 M248K probably benign Het
Chl1 G A 6: 103,695,495 D566N possibly damaging Het
Cntn4 A T 6: 106,679,895 I908F possibly damaging Het
Cyld T C 8: 88,742,302 I752T probably benign Het
Cyp26a1 C A 19: 37,700,624 L336I possibly damaging Het
Dlg2 A G 7: 92,438,156 probably null Het
Dmkn G A 7: 30,777,609 G446D probably damaging Het
Dnajc25 T C 4: 59,020,356 Y260H probably damaging Het
Dnm3 C A 1: 162,011,830 R186L probably damaging Het
Dst C T 1: 34,179,035 H1519Y possibly damaging Het
Eif1ad A G 19: 5,368,215 H9R probably damaging Het
Epha3 A T 16: 63,566,600 I891N probably benign Het
Epx T C 11: 87,874,311 T187A probably damaging Het
Fbln2 T G 6: 91,233,667 Y198D probably damaging Het
Fhod3 A G 18: 25,001,944 I371V probably benign Het
Gm11639 C T 11: 104,751,911 T1120I possibly damaging Het
Gm4922 C T 10: 18,784,348 V209I probably damaging Het
Gucy1a2 G A 9: 3,759,580 G462D probably damaging Het
Gzmd T C 14: 56,131,252 T62A probably damaging Het
Hnrnpul1 A T 7: 25,754,421 L72Q probably damaging Het
Ifi211 A T 1: 173,899,454 W375R probably damaging Het
Il1rl2 C A 1: 40,365,253 H511Q probably damaging Het
Kcnn2 A T 18: 45,559,438 H27L possibly damaging Het
Kng2 A G 16: 22,988,232 Y406H probably damaging Het
Lama1 A G 17: 67,780,597 E1491G Het
Lmf1 T C 17: 25,654,608 probably null Het
Med24 T C 11: 98,713,164 N417S possibly damaging Het
Mfsd4b5 T C 10: 39,974,800 E60G probably benign Het
Myo7b A G 18: 31,961,905 V1879A probably benign Het
Myrfl T A 10: 116,839,353 N225I possibly damaging Het
Naaladl2 A C 3: 24,413,348 probably null Het
Olfr1057 A G 2: 86,375,181 I77T probably damaging Het
Olfr820 T C 10: 130,017,534 Y58H probably damaging Het
Rasa3 A C 8: 13,588,015 L343R probably benign Het
Ros1 T G 10: 52,163,971 K308T probably damaging Het
Rp1l1 A G 14: 64,029,803 Y946C probably benign Het
Rpl13a A T 7: 45,126,173 L156Q probably damaging Het
Samd9l A G 6: 3,375,975 F429L possibly damaging Het
Slc25a25 A G 2: 32,451,209 V39A probably benign Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Sspo G A 6: 48,475,371 W2756* probably null Het
Sult6b2 T A 6: 142,786,359 N274I probably benign Het
Tbc1d14 G A 5: 36,495,038 R667W probably damaging Het
Tg T C 15: 66,715,163 S1597P probably damaging Het
Thy1 A G 9: 44,047,435 D158G probably damaging Het
Tns4 T C 11: 99,071,470 Y567C probably damaging Het
Vmn1r170 A G 7: 23,607,048 R292G probably damaging Het
Vmn2r120 C A 17: 57,536,657 R62S probably benign Het
Vmn2r88 T G 14: 51,417,989 C552G Het
Xpo4 T A 14: 57,589,959 I927F probably damaging Het
Zc3h7a A T 16: 11,139,026 C906* probably null Het
Zdhhc22 T C 12: 86,983,388 D262G probably benign Het
Zfc3h1 C T 10: 115,410,701 Q898* probably null Het
Zfp280d T A 9: 72,301,965 S126T probably damaging Het
Zfp652 G T 11: 95,749,718 E156D probably benign Het
Zfp74 T C 7: 29,935,183 R367G probably damaging Het
Other mutations in Ndrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Ndrg1 APN 15 66943110 missense probably damaging 1.00
IGL01419:Ndrg1 APN 15 66931051 missense probably benign 0.01
IGL02618:Ndrg1 APN 15 66940237 missense probably benign 0.03
IGL02869:Ndrg1 APN 15 66946497 missense probably benign 0.01
IGL03206:Ndrg1 APN 15 66943087 nonsense probably null
PIT4377001:Ndrg1 UTSW 15 66948439 missense probably benign
R0328:Ndrg1 UTSW 15 66943159 splice site probably benign
R1102:Ndrg1 UTSW 15 66944836 missense probably damaging 1.00
R1105:Ndrg1 UTSW 15 66940231 missense probably damaging 0.99
R1748:Ndrg1 UTSW 15 66931081 missense possibly damaging 0.55
R1875:Ndrg1 UTSW 15 66931091 missense possibly damaging 0.91
R5214:Ndrg1 UTSW 15 66959390 missense probably damaging 0.99
R5809:Ndrg1 UTSW 15 66930850 unclassified probably benign
R6433:Ndrg1 UTSW 15 66933872 missense probably damaging 1.00
R7104:Ndrg1 UTSW 15 66946528 missense probably damaging 1.00
R7412:Ndrg1 UTSW 15 66960533 start codon destroyed probably null 1.00
R7424:Ndrg1 UTSW 15 66944938 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATTGTAACACTTGTTAGGCAGC -3'
(R):5'- TGGGGTATCCTCAGAACACAG -3'

Sequencing Primer
(F):5'- TAACACTTGTTAGGCAGCAGTGG -3'
(R):5'- TATCCTCAGAACACAGTTGGG -3'
Posted On2019-11-12