Incidental Mutation 'R7667:Kng2'
ID 592011
Institutional Source Beutler Lab
Gene Symbol Kng2
Ensembl Gene ENSMUSG00000060459
Gene Name kininogen 2
Synonyms Kininogen-II
MMRRC Submission 045740-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7667 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 22804602-22847851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22806982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 406 (Y406H)
Ref Sequence ENSEMBL: ENSMUSP00000097623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039338] [ENSMUST00000100046] [ENSMUST00000115349] [ENSMUST00000160243]
AlphaFold Q6S9I3
Predicted Effect probably benign
Transcript: ENSMUST00000039338
SMART Domains Protein: ENSMUSP00000046867
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100046
AA Change: Y406H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097623
Gene: ENSMUSG00000060459
AA Change: Y406H

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115349
SMART Domains Protein: ENSMUSP00000111006
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160243
SMART Domains Protein: ENSMUSP00000124161
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
Blast:CY 140 171 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231872
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,383,953 (GRCm39) probably null Het
Adgrf5 A C 17: 43,756,930 (GRCm39) I675L probably benign Het
Arhgap24 T A 5: 103,026,323 (GRCm39) M248K probably benign Het
Chl1 G A 6: 103,672,456 (GRCm39) D566N possibly damaging Het
Cntn4 A T 6: 106,656,856 (GRCm39) I908F possibly damaging Het
Cyld T C 8: 89,468,930 (GRCm39) I752T probably benign Het
Cyp26a1 C A 19: 37,689,072 (GRCm39) L336I possibly damaging Het
Dlg2 A G 7: 92,087,364 (GRCm39) probably null Het
Dmkn G A 7: 30,477,034 (GRCm39) G446D probably damaging Het
Dnajc25 T C 4: 59,020,356 (GRCm39) Y260H probably damaging Het
Dnm3 C A 1: 161,839,399 (GRCm39) R186L probably damaging Het
Dst C T 1: 34,218,116 (GRCm39) H1519Y possibly damaging Het
Efcab3 C T 11: 104,642,737 (GRCm39) T1120I possibly damaging Het
Eif1ad A G 19: 5,418,243 (GRCm39) H9R probably damaging Het
Epha3 A T 16: 63,386,963 (GRCm39) I891N probably benign Het
Epx T C 11: 87,765,137 (GRCm39) T187A probably damaging Het
Fbln2 T G 6: 91,210,649 (GRCm39) Y198D probably damaging Het
Fhod3 A G 18: 25,135,001 (GRCm39) I371V probably benign Het
Gm4922 C T 10: 18,660,096 (GRCm39) V209I probably damaging Het
Gucy1a2 G A 9: 3,759,580 (GRCm39) G462D probably damaging Het
Gzmd T C 14: 56,368,709 (GRCm39) T62A probably damaging Het
Hnrnpul1 A T 7: 25,453,846 (GRCm39) L72Q probably damaging Het
Ifi211 A T 1: 173,727,020 (GRCm39) W375R probably damaging Het
Il1rl2 C A 1: 40,404,413 (GRCm39) H511Q probably damaging Het
Kcnn2 A T 18: 45,692,505 (GRCm39) H27L possibly damaging Het
Lama1 A G 17: 68,087,592 (GRCm39) E1491G Het
Lmf1 T C 17: 25,873,582 (GRCm39) probably null Het
Med24 T C 11: 98,603,990 (GRCm39) N417S possibly damaging Het
Mfsd4b5 T C 10: 39,850,796 (GRCm39) E60G probably benign Het
Myo7b A G 18: 32,094,958 (GRCm39) V1879A probably benign Het
Myrfl T A 10: 116,675,258 (GRCm39) N225I possibly damaging Het
Naaladl2 A C 3: 24,467,512 (GRCm39) probably null Het
Ndrg1 C T 15: 66,820,243 (GRCm39) D64N probably damaging Het
Or6c33 T C 10: 129,853,403 (GRCm39) Y58H probably damaging Het
Or8j3b A G 2: 86,205,525 (GRCm39) I77T probably damaging Het
Rasa3 A C 8: 13,638,015 (GRCm39) L343R probably benign Het
Ros1 T G 10: 52,040,067 (GRCm39) K308T probably damaging Het
Rp1l1 A G 14: 64,267,252 (GRCm39) Y946C probably benign Het
Rpl13a A T 7: 44,775,597 (GRCm39) L156Q probably damaging Het
Samd9l A G 6: 3,375,975 (GRCm39) F429L possibly damaging Het
Slc25a25 A G 2: 32,341,221 (GRCm39) V39A probably benign Het
Snrnp27 A T 6: 86,657,935 (GRCm39) I101K possibly damaging Het
Sspo G A 6: 48,452,305 (GRCm39) W2756* probably null Het
Sult6b2 T A 6: 142,732,085 (GRCm39) N274I probably benign Het
Tbc1d14 G A 5: 36,652,382 (GRCm39) R667W probably damaging Het
Tg T C 15: 66,587,012 (GRCm39) S1597P probably damaging Het
Thy1 A G 9: 43,958,732 (GRCm39) D158G probably damaging Het
Tns4 T C 11: 98,962,296 (GRCm39) Y567C probably damaging Het
Vmn1r170 A G 7: 23,306,473 (GRCm39) R292G probably damaging Het
Vmn2r120 C A 17: 57,843,657 (GRCm39) R62S probably benign Het
Vmn2r88 T G 14: 51,655,446 (GRCm39) C552G Het
Xpo4 T A 14: 57,827,416 (GRCm39) I927F probably damaging Het
Zc3h7a A T 16: 10,956,890 (GRCm39) C906* probably null Het
Zdhhc22 T C 12: 87,030,162 (GRCm39) D262G probably benign Het
Zfc3h1 C T 10: 115,246,606 (GRCm39) Q898* probably null Het
Zfp280d T A 9: 72,209,247 (GRCm39) S126T probably damaging Het
Zfp652 G T 11: 95,640,544 (GRCm39) E156D probably benign Het
Zfp74 T C 7: 29,634,608 (GRCm39) R367G probably damaging Het
Other mutations in Kng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Kng2 APN 16 22,847,580 (GRCm39) missense probably damaging 1.00
IGL01319:Kng2 APN 16 22,847,584 (GRCm39) missense probably damaging 0.99
IGL01469:Kng2 APN 16 22,818,577 (GRCm39) missense probably damaging 1.00
IGL01681:Kng2 APN 16 22,815,767 (GRCm39) splice site probably benign
IGL01830:Kng2 APN 16 22,806,801 (GRCm39) missense probably damaging 0.97
IGL01903:Kng2 APN 16 22,806,540 (GRCm39) missense possibly damaging 0.80
IGL02146:Kng2 APN 16 22,806,582 (GRCm39) missense probably damaging 0.97
IGL02305:Kng2 APN 16 22,819,374 (GRCm39) unclassified probably benign
IGL02429:Kng2 APN 16 22,830,829 (GRCm39) missense probably damaging 0.99
FR4548:Kng2 UTSW 16 22,819,302 (GRCm39) nonsense probably null
R0020:Kng2 UTSW 16 22,816,046 (GRCm39) missense probably benign 0.02
R0047:Kng2 UTSW 16 22,806,313 (GRCm39) missense possibly damaging 0.83
R0245:Kng2 UTSW 16 22,830,931 (GRCm39) splice site probably benign
R0610:Kng2 UTSW 16 22,819,344 (GRCm39) missense possibly damaging 0.96
R0646:Kng2 UTSW 16 22,806,486 (GRCm39) missense probably benign 0.10
R0666:Kng2 UTSW 16 22,815,872 (GRCm39) splice site probably benign
R1552:Kng2 UTSW 16 22,806,270 (GRCm39) missense probably damaging 1.00
R1765:Kng2 UTSW 16 22,806,993 (GRCm39) critical splice donor site probably null
R1833:Kng2 UTSW 16 22,830,802 (GRCm39) missense possibly damaging 0.95
R1997:Kng2 UTSW 16 22,843,626 (GRCm39) missense possibly damaging 0.84
R2025:Kng2 UTSW 16 22,819,325 (GRCm39) missense probably benign 0.15
R2056:Kng2 UTSW 16 22,806,703 (GRCm39) intron probably benign
R2137:Kng2 UTSW 16 22,816,076 (GRCm39) intron probably benign
R2517:Kng2 UTSW 16 22,807,065 (GRCm39) missense probably benign 0.24
R3438:Kng2 UTSW 16 22,830,821 (GRCm39) missense probably benign 0.23
R3439:Kng2 UTSW 16 22,830,821 (GRCm39) missense probably benign 0.23
R3551:Kng2 UTSW 16 22,830,745 (GRCm39) critical splice donor site probably null
R4389:Kng2 UTSW 16 22,843,618 (GRCm39) missense possibly damaging 0.91
R4538:Kng2 UTSW 16 22,806,813 (GRCm39) missense probably benign 0.00
R4684:Kng2 UTSW 16 22,806,391 (GRCm39) missense possibly damaging 0.93
R4978:Kng2 UTSW 16 22,806,666 (GRCm39) missense probably damaging 1.00
R5658:Kng2 UTSW 16 22,815,770 (GRCm39) splice site probably null
R6074:Kng2 UTSW 16 22,819,346 (GRCm39) missense probably benign 0.03
R6216:Kng2 UTSW 16 22,806,343 (GRCm39) missense probably damaging 1.00
R6271:Kng2 UTSW 16 22,822,698 (GRCm39) missense probably benign 0.33
R6459:Kng2 UTSW 16 22,830,865 (GRCm39) missense probably damaging 1.00
R7124:Kng2 UTSW 16 22,830,805 (GRCm39) missense probably damaging 1.00
R7310:Kng2 UTSW 16 22,806,522 (GRCm39) missense probably benign 0.00
R7532:Kng2 UTSW 16 22,845,794 (GRCm39) splice site probably null
R7787:Kng2 UTSW 16 22,818,598 (GRCm39) missense probably damaging 1.00
R8092:Kng2 UTSW 16 22,806,672 (GRCm39) missense probably benign 0.00
R8165:Kng2 UTSW 16 22,806,246 (GRCm39) missense unknown
R8814:Kng2 UTSW 16 22,822,761 (GRCm39) missense probably benign 0.00
R9019:Kng2 UTSW 16 22,847,546 (GRCm39) missense probably damaging 0.99
R9048:Kng2 UTSW 16 22,806,522 (GRCm39) missense probably benign 0.00
R9531:Kng2 UTSW 16 22,830,907 (GRCm39) missense possibly damaging 0.81
R9708:Kng2 UTSW 16 22,815,801 (GRCm39) missense probably damaging 0.99
R9764:Kng2 UTSW 16 22,822,737 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTATGGTCACTGCCATC -3'
(R):5'- GGCATCATCAGGTGCTTAGTCTC -3'

Sequencing Primer
(F):5'- TCAAGTTTAAGTCGATGTCCATGACC -3'
(R):5'- ATCATCAGGTGCTTAGTCTCTTCTTC -3'
Posted On 2019-11-12