Incidental Mutation 'R7669:Nectin4'
ID592022
Institutional Source Beutler Lab
Gene Symbol Nectin4
Ensembl Gene ENSMUSG00000006411
Gene Namenectin cell adhesion molecule 4
Synonyms1200017F15Rik, Prr4, Pvrl4, nectin 4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171370099-171388598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171380259 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 73 (E73G)
Ref Sequence ENSEMBL: ENSMUSP00000006578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006578] [ENSMUST00000094325] [ENSMUST00000111286]
Predicted Effect probably benign
Transcript: ENSMUST00000006578
AA Change: E73G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000006578
Gene: ENSMUSG00000006411
AA Change: E73G

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 4e-4 PFAM
Pfam:C2-set_2 150 233 9e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094325
AA Change: E73G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091883
Gene: ENSMUSG00000006411
AA Change: E73G

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 2.1e-4 PFAM
Pfam:C2-set_2 150 233 8.7e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111286
AA Change: E73G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106917
Gene: ENSMUSG00000006411
AA Change: E73G

DomainStartEndE-ValueType
IG 100 209 9.26e-8 SMART
Pfam:C2-set_2 214 297 1.2e-16 PFAM
IGc2 323 385 9.78e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Nectin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Nectin4 APN 1 171384686 missense probably damaging 1.00
IGL01558:Nectin4 APN 1 171384689 missense probably benign 0.00
IGL02608:Nectin4 APN 1 171384773 missense probably benign 0.05
R2047:Nectin4 UTSW 1 171385152 missense possibly damaging 0.61
R2203:Nectin4 UTSW 1 171386229 missense possibly damaging 0.78
R2518:Nectin4 UTSW 1 171380208 missense probably benign 0.00
R4125:Nectin4 UTSW 1 171385733 missense probably benign 0.02
R4708:Nectin4 UTSW 1 171385146 missense probably benign 0.02
R4856:Nectin4 UTSW 1 171384815 missense possibly damaging 0.46
R4886:Nectin4 UTSW 1 171384815 missense possibly damaging 0.46
R5222:Nectin4 UTSW 1 171385257 splice site probably null
R5264:Nectin4 UTSW 1 171383705 missense probably benign 0.00
R5661:Nectin4 UTSW 1 171385170 missense probably damaging 1.00
R6466:Nectin4 UTSW 1 171386753 missense probably damaging 1.00
R6714:Nectin4 UTSW 1 171370650 start gained probably benign
R7272:Nectin4 UTSW 1 171386644 missense probably damaging 1.00
R7302:Nectin4 UTSW 1 171386635 nonsense probably null
R7318:Nectin4 UTSW 1 171380463 missense probably benign 0.16
R7732:Nectin4 UTSW 1 171386678 missense probably benign 0.00
R7751:Nectin4 UTSW 1 171383758 critical splice donor site probably null
R7912:Nectin4 UTSW 1 171380373 missense possibly damaging 0.86
R7993:Nectin4 UTSW 1 171380373 missense possibly damaging 0.86
R8029:Nectin4 UTSW 1 171386687 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCGCCTTTGCTGTCATTAG -3'
(R):5'- GCTGACTCTGCATTCGTACTCG -3'

Sequencing Primer
(F):5'- ATGCGTTCCATTGGTTCTGAC -3'
(R):5'- GCCCTCATCAGCTTGCACAG -3'
Posted On2019-11-12