Incidental Mutation 'R7669:Gstm2'
ID592029
Institutional Source Beutler Lab
Gene Symbol Gstm2
Ensembl Gene ENSMUSG00000040562
Gene Nameglutathione S-transferase, mu 2
SynonymsGstb2, Gstb-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location107981702-107986453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107985676 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 40 (D40A)
Ref Sequence ENSEMBL: ENSMUSP00000012348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012348] [ENSMUST00000066530]
Predicted Effect probably benign
Transcript: ENSMUST00000012348
AA Change: D40A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000012348
Gene: ENSMUSG00000040562
AA Change: D40A

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.9e-24 PFAM
Pfam:GST_C_3 41 190 1.2e-10 PFAM
Pfam:GST_C 104 191 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066530
AA Change: D6A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066675
Gene: ENSMUSG00000040562
AA Change: D6A

DomainStartEndE-ValueType
Pfam:GST_N 1 48 6.8e-12 PFAM
Pfam:GST_C 70 158 8.4e-20 PFAM
Pfam:GST_C_3 84 156 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Gstm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Gstm2 APN 3 107985243 splice site probably null
IGL01821:Gstm2 APN 3 107985053 missense possibly damaging 0.51
IGL02662:Gstm2 APN 3 107985062 missense possibly damaging 0.94
IGL02667:Gstm2 APN 3 107986108 missense probably damaging 1.00
IGL03088:Gstm2 APN 3 107986046 missense probably benign 0.00
IGL03341:Gstm2 APN 3 107984205 missense possibly damaging 0.86
R0415:Gstm2 UTSW 3 107984006 missense probably benign 0.37
R1239:Gstm2 UTSW 3 107984028 missense possibly damaging 0.61
R2213:Gstm2 UTSW 3 107986093 missense probably damaging 1.00
R2437:Gstm2 UTSW 3 107984053 splice site probably benign
R3765:Gstm2 UTSW 3 107984030 missense probably damaging 1.00
R4402:Gstm2 UTSW 3 107986054 missense probably benign 0.02
R4805:Gstm2 UTSW 3 107985095 missense possibly damaging 0.92
R5791:Gstm2 UTSW 3 107984128 critical splice donor site probably null
R6918:Gstm2 UTSW 3 107985241 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCACTGAATGGGAGAGCTG -3'
(R):5'- TGGGTTCTCTTTTCAACTAATTGGC -3'

Sequencing Primer
(F):5'- CACTGTGCAGCCAACAGG -3'
(R):5'- TTTCAACTAATTGGCTTATTCAAACC -3'
Posted On2019-11-12