Incidental Mutation 'R7669:Arhgap29'
ID592030
Institutional Source Beutler Lab
Gene Symbol Arhgap29
Ensembl Gene ENSMUSG00000039831
Gene NameRho GTPase activating protein 29
SynonymsB130017I01Rik, 6720461J18Rik, C76601, Parg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7669 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location121952541-122016753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121992812 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 342 (A342V)
Ref Sequence ENSEMBL: ENSMUSP00000044624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000196479] [ENSMUST00000196904] [ENSMUST00000197155]
Predicted Effect probably damaging
Transcript: ENSMUST00000037958
AA Change: A342V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: A342V

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 5e-41 PDB
Blast:RhoGAP 412 595 9e-84 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 885 1.92e-68 SMART
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196479
SMART Domains Protein: ENSMUSP00000142817
Gene: ENSMUSG00000039831

DomainStartEndE-ValueType
PDB:3QWE|A 129 271 1e-28 PDB
Blast:FCH 133 220 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196904
Predicted Effect probably damaging
Transcript: ENSMUST00000197155
AA Change: A342V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: A342V

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 8e-42 PDB
Blast:RhoGAP 412 595 2e-87 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 780 1.14e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198914
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Arhgap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Arhgap29 APN 3 122003312 nonsense probably null
IGL01121:Arhgap29 APN 3 122009863 missense probably damaging 1.00
IGL01622:Arhgap29 APN 3 121974124 splice site probably benign
IGL01623:Arhgap29 APN 3 121974124 splice site probably benign
IGL01995:Arhgap29 APN 3 122014328 missense probably benign 0.00
IGL02120:Arhgap29 APN 3 122004257 missense probably benign 0.05
IGL02554:Arhgap29 APN 3 121992524 unclassified probably benign
IGL02931:Arhgap29 APN 3 121992860 missense probably benign
IGL02937:Arhgap29 APN 3 121974049 missense probably damaging 0.99
PIT4362001:Arhgap29 UTSW 3 122003212 missense probably benign 0.42
R0022:Arhgap29 UTSW 3 121988937 missense possibly damaging 0.61
R0574:Arhgap29 UTSW 3 122007625 missense probably benign 0.01
R0601:Arhgap29 UTSW 3 121991110 missense probably damaging 1.00
R0639:Arhgap29 UTSW 3 122007641 missense probably damaging 1.00
R0881:Arhgap29 UTSW 3 122014679 missense probably damaging 1.00
R1232:Arhgap29 UTSW 3 122003340 missense probably damaging 1.00
R1295:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1296:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1470:Arhgap29 UTSW 3 121992319 unclassified probably benign
R1710:Arhgap29 UTSW 3 122008080 missense probably damaging 1.00
R1878:Arhgap29 UTSW 3 122011371 missense probably damaging 1.00
R2051:Arhgap29 UTSW 3 121981860 missense probably benign 0.01
R2112:Arhgap29 UTSW 3 122011561 missense probably benign 0.03
R2188:Arhgap29 UTSW 3 121991009 missense probably damaging 1.00
R2240:Arhgap29 UTSW 3 122011453 missense probably benign 0.12
R2420:Arhgap29 UTSW 3 121973980 missense probably benign
R3618:Arhgap29 UTSW 3 121988527 missense possibly damaging 0.62
R4673:Arhgap29 UTSW 3 122014971 missense probably damaging 1.00
R4717:Arhgap29 UTSW 3 122009958 missense possibly damaging 0.82
R5028:Arhgap29 UTSW 3 122010060 critical splice donor site probably null
R5043:Arhgap29 UTSW 3 121974004 missense probably benign 0.00
R5045:Arhgap29 UTSW 3 122002595 missense probably benign 0.28
R5463:Arhgap29 UTSW 3 121988551 missense possibly damaging 0.94
R5495:Arhgap29 UTSW 3 122014929 missense probably damaging 1.00
R5743:Arhgap29 UTSW 3 121981911 missense probably damaging 1.00
R5791:Arhgap29 UTSW 3 122014245 missense probably damaging 0.98
R5896:Arhgap29 UTSW 3 122012087 missense possibly damaging 0.78
R6083:Arhgap29 UTSW 3 121992748 missense probably benign 0.00
R6355:Arhgap29 UTSW 3 122011258 missense possibly damaging 0.46
R6451:Arhgap29 UTSW 3 121993581 missense probably damaging 1.00
R6528:Arhgap29 UTSW 3 122014702 missense probably benign 0.13
R7239:Arhgap29 UTSW 3 121988950 missense probably benign 0.16
R7807:Arhgap29 UTSW 3 122014332 missense probably benign 0.01
R8045:Arhgap29 UTSW 3 122007562 synonymous silent
R8048:Arhgap29 UTSW 3 121992901 missense probably damaging 1.00
R8165:Arhgap29 UTSW 3 121988573 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGTTTATCCAAAATTGCCTGCG -3'
(R):5'- TAACAAACTCCTCCGCTTGC -3'

Sequencing Primer
(F):5'- TTGCCTGCGATATATAAACCACCTG -3'
(R):5'- GCTTGCCAAAACAGTGGTTC -3'
Posted On2019-11-12