Mutagenetix > Incidental Mutations

Incidental Mutation 'R7669:Arhgap29'

592030

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7669 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 121992812 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 342 (A342V)

Ref Sequence

ENSEMBL: ENSMUSP00000044624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000196479] [ENSMUST00000196904] [ENSMUST00000197155]

AlphaFold

Q8CGF1

Predicted Effect

probably damaging
Transcript: ENSMUST00000037958
AA Change: A342V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: A342V

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196479

SMART Domains

Protein: ENSMUSP00000142817
Gene: ENSMUSG00000039831

Domain	Start	End	E-Value	Type
PDB:3QWE\|A	129	271	1e-28	PDB
Blast:FCH	133	220	1e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000196904

Predicted Effect

probably damaging
Transcript: ENSMUST00000197155
AA Change: A342V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: A342V

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	8e-42	PDB
Blast:RhoGAP	412	595	2e-87	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	780	1.14e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000198914

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
5830411N06Rik	A	G	7: 140,296,321	S569G	possibly damaging	Het
Aars2	C	T	17: 45,520,295	P930S	probably benign	Het
Ada	T	A	2: 163,728,191	K301*	probably null	Het
Alb	T	C	5: 90,463,991	L93P	possibly damaging	Het
Aldh1l1	G	A	6: 90,570,862	G435S	probably benign	Het
Alox12b	A	T	11: 69,169,341	I627F	probably benign	Het
Aloxe3	A	G	11: 69,135,120	I503V	probably benign	Het
BC024139	G	A	15: 76,120,568	P636L	possibly damaging	Het
Bmp6	G	T	13: 38,484,920	R293L	probably damaging	Het
Cfd	G	A	10: 79,891,613		probably null	Het
Csmd1	C	T	8: 15,917,273	A3197T	probably damaging	Het
Flii	G	A	11: 60,722,664	L166F	probably damaging	Het
Fmn1	T	A	2: 113,365,477	N507K	unknown	Het
Foxe1	C	A	4: 46,344,545	R118S	possibly damaging	Het
Fras1	T	C	5: 96,692,624	V1646A	probably benign	Het
Gm14496	A	G	2: 181,995,918	T262A	possibly damaging	Het
Gpbp1	A	T	13: 111,439,124	S282T	probably benign	Het
Gria4	A	T	9: 4,462,029	N641K	probably damaging	Het
Grin2a	T	G	16: 9,992,463	N24T	probably benign	Het
Gstm2	T	G	3: 107,985,676	D40A	probably benign	Het
H2afy	T	C	13: 56,128,333	Y39C	probably damaging	Het
Heatr1	T	A	13: 12,411,262	I657N	probably benign	Het
Kmt2b	T	C	7: 30,583,231	E1102G	possibly damaging	Het
Mgam	T	A	6: 40,659,010	N366K	probably benign	Het
Mier2	A	T	10: 79,549,676	V35E	probably damaging	Het
Mlxipl	T	C	5: 135,132,370	F381S	possibly damaging	Het
Mroh1	A	G	15: 76,451,848	H1474R	possibly damaging	Het
Mtrf1l	G	T	10: 5,815,620	A239E	probably damaging	Het
Nbea	G	T	3: 55,717,779	A2297E	probably damaging	Het
Nectin4	A	G	1: 171,380,259	E73G	probably benign	Het
Neurl1b	C	G	17: 26,438,746	H219Q	probably benign	Het
Nfia	G	A	4: 97,783,505	V151I	probably damaging	Het
Nol6	A	G	4: 41,118,717	L720P	probably damaging	Het
Olfr58	A	G	9: 19,783,543	N137D	possibly damaging	Het
Olfr772	A	G	10: 129,174,259	F254S	probably damaging	Het
Patj	A	G	4: 98,518,942	E1054G	probably damaging	Het
Pcnx	A	G	12: 81,990,551	D1861G	probably damaging	Het
Prss12	A	G	3: 123,447,396	T80A	probably benign	Het
Sgsm1	C	A	5: 113,253,024	R1000L	probably damaging	Het
Sulf2	T	C	2: 166,093,596	D199G	possibly damaging	Het
Suox	T	C	10: 128,670,911	D416G	probably benign	Het
Syne1	G	A	10: 5,061,531	T38M	probably damaging	Het
Tcf7l2	T	A	19: 55,924,543	C421*	probably null	Het
Traf7	C	A	17: 24,513,308	G143*	probably null	Het
Trappc12	T	C	12: 28,711,958	I544V	probably benign	Het
Trmt1	G	A	8: 84,697,551	V434I	probably benign	Het
Ttc5	T	C	14: 50,777,330	H160R	probably benign	Het
Xirp2	T	A	2: 67,512,177	H1587Q	probably benign	Het
Zfp523	C	T	17: 28,201,041	T220M	probably damaging	Het
Zfp804b	A	T	5: 6,769,362	S1234T	probably damaging	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1232:Arhgap29	UTSW	3	122003340	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2112:Arhgap29	UTSW	3	122011561	missense	probably benign	0.03
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5045:Arhgap29	UTSW	3	122002595	missense	probably benign	0.28
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5495:Arhgap29	UTSW	3	122014929	missense	probably damaging	1.00
R5743:Arhgap29	UTSW	3	121981911	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R6528:Arhgap29	UTSW	3	122014702	missense	probably benign	0.13
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7807:Arhgap29	UTSW	3	122014332	missense	probably benign	0.01
R8045:Arhgap29	UTSW	3	122007562	synonymous	silent
R8048:Arhgap29	UTSW	3	121992901	missense	probably damaging	1.00
R8165:Arhgap29	UTSW	3	121988573	missense	probably damaging	0.98
R9001:Arhgap29	UTSW	3	121981874	missense	probably benign	0.03
R9032:Arhgap29	UTSW	3	122014600	missense	probably benign
R9060:Arhgap29	UTSW	3	121990324	missense	probably damaging	0.99
R9085:Arhgap29	UTSW	3	122014600	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTGTTTATCCAAAATTGCCTGCG -3'
(R):5'- TAACAAACTCCTCCGCTTGC -3'

Sequencing Primer
(F):5'- TTGCCTGCGATATATAAACCACCTG -3'
(R):5'- GCTTGCCAAAACAGTGGTTC -3'

Posted On

2019-11-12