Incidental Mutation 'R7669:Prss12'
ID592031
Institutional Source Beutler Lab
Gene Symbol Prss12
Ensembl Gene ENSMUSG00000027978
Gene Nameprotease, serine 12 neurotrypsin (motopsin)
Synonymsmotopsin, Bssp-3
Accession Numbers

Genbank: NM_008939.2

Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R7669 (G1)
Quality Score165.009
Status Not validated
Chromosome3
Chromosomal Location123446913-123506597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123447396 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000029603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029603]
Predicted Effect probably benign
Transcript: ENSMUST00000029603
AA Change: T80A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029603
Gene: ENSMUSG00000027978
AA Change: T80A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 43 N/A INTRINSIC
low complexity region 45 64 N/A INTRINSIC
KR 83 159 2.07e-21 SMART
SR 166 266 4.68e-57 SMART
SR 273 372 9.67e-50 SMART
SR 386 486 3.55e-57 SMART
Tryp_SPc 516 755 6.38e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. Studies in mouse suggest that the encoded enzyme may be involved in structural reorganizations associated with learning and memory. The enzyme is also expressed in Leydig cells in the testis, but its function in this tissue is unknown. Defects in this gene are a cause of mental retardation autosomal recessive type 1 (MRT1). [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display hypoactivity and increased anxiety. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Prss12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Prss12 APN 3 123486949 splice site probably benign
IGL01090:Prss12 APN 3 123482739 missense possibly damaging 0.85
IGL01609:Prss12 APN 3 123482834 missense probably damaging 1.00
IGL02406:Prss12 APN 3 123505474 missense possibly damaging 0.81
IGL02445:Prss12 APN 3 123487020 missense probably damaging 1.00
IGL02928:Prss12 APN 3 123487156 missense possibly damaging 0.51
IGL02970:Prss12 APN 3 123482762 missense probably benign 0.03
IGL03116:Prss12 APN 3 123506276 missense probably benign
IGL03149:Prss12 APN 3 123505387 missense probably benign 0.00
nerd UTSW 3 123447384 missense probably benign 0.31
twerp UTSW 3 123482774 missense probably damaging 1.00
F5426:Prss12 UTSW 3 123506472 missense probably damaging 1.00
P4717OSA:Prss12 UTSW 3 123447618 missense probably damaging 1.00
PIT4576001:Prss12 UTSW 3 123487115 missense probably damaging 1.00
R0116:Prss12 UTSW 3 123482774 missense probably damaging 1.00
R0528:Prss12 UTSW 3 123482796 missense probably benign 0.00
R0762:Prss12 UTSW 3 123485504 missense probably damaging 1.00
R1051:Prss12 UTSW 3 123485525 missense probably null 0.99
R1916:Prss12 UTSW 3 123506495 missense probably benign 0.07
R2185:Prss12 UTSW 3 123487144 missense probably benign 0.01
R2389:Prss12 UTSW 3 123487021 missense possibly damaging 0.63
R2938:Prss12 UTSW 3 123486976 missense probably benign 0.00
R3118:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R3119:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R4080:Prss12 UTSW 3 123485485 missense probably benign 0.44
R4161:Prss12 UTSW 3 123485527 nonsense probably null
R4997:Prss12 UTSW 3 123447208 missense probably benign 0.01
R5291:Prss12 UTSW 3 123505463 missense probably damaging 0.98
R5597:Prss12 UTSW 3 123464740 missense probably benign 0.18
R5941:Prss12 UTSW 3 123505501 missense probably benign 0.01
R6005:Prss12 UTSW 3 123482768 missense probably benign 0.00
R6119:Prss12 UTSW 3 123489609 missense possibly damaging 0.64
R6430:Prss12 UTSW 3 123479594 missense probably damaging 1.00
R6492:Prss12 UTSW 3 123447399 missense probably benign
R6864:Prss12 UTSW 3 123447384 missense probably benign 0.31
R7334:Prss12 UTSW 3 123487131 missense probably benign
R7492:Prss12 UTSW 3 123482776 nonsense probably null
R7898:Prss12 UTSW 3 123506496 missense possibly damaging 0.55
R7981:Prss12 UTSW 3 123506496 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACTGTCTGTAGTGGCCCG -3'
(R):5'- CTGGGCATTCCGATAGAAGC -3'

Sequencing Primer
(F):5'- TAGTGGCCCGCGCTGATC -3'
(R):5'- TTCCGATAGAAGCACCAAGGTCTG -3'
Posted On2019-11-12