Incidental Mutation 'R7669:Nfia'
ID592034
Institutional Source Beutler Lab
Gene Symbol Nfia
Ensembl Gene ENSMUSG00000028565
Gene Namenuclear factor I/A
Synonyms9430022M17Rik, NF1-A, 1110047K16Rik, NF1A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location97772734-98118874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97783505 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 151 (V151I)
Ref Sequence ENSEMBL: ENSMUSP00000074899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052018] [ENSMUST00000075448] [ENSMUST00000092532] [ENSMUST00000107057] [ENSMUST00000107062] [ENSMUST00000152023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052018
AA Change: V151I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099856
Gene: ENSMUSG00000028565
AA Change: V151I

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.6e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 192 487 7.3e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075448
AA Change: V151I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074899
Gene: ENSMUSG00000028565
AA Change: V151I

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 6 46 5.6e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 508 1.8e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092532
AA Change: V151I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130032
Gene: ENSMUSG00000028565
AA Change: V151I

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 318 4.1e-48 PFAM
Pfam:CTF_NFI 315 466 1.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107057
AA Change: V151I

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102672
Gene: ENSMUSG00000028565
AA Change: V151I

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 180 380 7.8e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107062
AA Change: V151I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102677
Gene: ENSMUSG00000028565
AA Change: V151I

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.7e-31 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 494 6.2e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152023
AA Change: V143I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114880
Gene: ENSMUSG00000028565
AA Change: V143I

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 2.6e-28 PFAM
DWA 59 167 2.4e-21 SMART
low complexity region 178 193 N/A INTRINSIC
Pfam:CTF_NFI 206 225 2.8e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NF1 (nuclear factor 1) family of transcription factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display perinatal lethality, hydrocephalus, agenesis of the corpus callosum and hippocampal commissure. Fertility is surviving homozygotes is compromised. A decrease in the number of heterozygous animals is associated with a maternal effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Nfia
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Nfia APN 4 98065386 missense probably damaging 0.97
IGL02663:Nfia APN 4 98041619 missense probably benign 0.14
IGL02691:Nfia APN 4 98081808 nonsense probably null
IGL02705:Nfia APN 4 97783368 missense probably damaging 1.00
IGL03226:Nfia APN 4 98063049 missense probably damaging 0.97
R0400:Nfia UTSW 4 98063136 missense probably damaging 0.96
R0611:Nfia UTSW 4 97783457 missense possibly damaging 0.75
R1568:Nfia UTSW 4 98111224 missense possibly damaging 0.93
R1716:Nfia UTSW 4 98063128 missense probably damaging 0.98
R3855:Nfia UTSW 4 98063022 missense probably damaging 1.00
R4038:Nfia UTSW 4 98020837 missense probably damaging 1.00
R4441:Nfia UTSW 4 97772913 critical splice donor site probably null
R4849:Nfia UTSW 4 98081811 missense probably damaging 1.00
R5184:Nfia UTSW 4 97783348 missense probably damaging 0.99
R5201:Nfia UTSW 4 98111225 missense probably damaging 0.98
R5254:Nfia UTSW 4 98014297 missense probably damaging 0.99
R5391:Nfia UTSW 4 97783301 missense probably damaging 0.96
R5551:Nfia UTSW 4 98014260 missense probably damaging 0.98
R5794:Nfia UTSW 4 97783601 missense possibly damaging 0.92
R5905:Nfia UTSW 4 98111251 missense possibly damaging 0.82
R5965:Nfia UTSW 4 98111292 makesense probably null
R6028:Nfia UTSW 4 98111251 missense possibly damaging 0.82
R7246:Nfia UTSW 4 98065342 missense probably damaging 1.00
X0018:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0019:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0020:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0021:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0022:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0023:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0024:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0027:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0050:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0052:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0053:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0054:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0057:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0058:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0060:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0061:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0062:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0063:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0064:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0065:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0066:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0067:Nfia UTSW 4 98041655 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTCTGGCCAAGTTACGGAAAG -3'
(R):5'- GTCACAGAGGCCATCAGAAG -3'

Sequencing Primer
(F):5'- TCTGGCCAAGTTACGGAAAGATATCC -3'
(R):5'- CAGAGGCCATCAGAAGAGACAC -3'
Posted On2019-11-12