Incidental Mutation 'R7669:Mlxipl'
ID592040
Institutional Source Beutler Lab
Gene Symbol Mlxipl
Ensembl Gene ENSMUSG00000005373
Gene NameMLX interacting protein-like
SynonymsWS-bHLH, Wbscr14, bHLHd14, ChREBP
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.537) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135089890-135138382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135132370 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 381 (F381S)
Ref Sequence ENSEMBL: ENSMUSP00000005507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005507] [ENSMUST00000128691] [ENSMUST00000129008] [ENSMUST00000142385] [ENSMUST00000153519]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005507
AA Change: F381S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005507
Gene: ENSMUSG00000005373
AA Change: F381S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 1e-8 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
HLH 667 721 1.14e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123370
SMART Domains Protein: ENSMUSP00000116358
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
HLH 19 73 1.14e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128691
AA Change: F381S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121348
Gene: ENSMUSG00000005373
AA Change: F381S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1hloa_ 658 709 6e-7 SMART
Blast:HLH 667 699 1e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000129008
AA Change: F381S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114933
Gene: ENSMUSG00000005373
AA Change: F381S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142385
AA Change: F381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144328
Gene: ENSMUSG00000005373
AA Change: F381S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153519
AA Change: F381S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122198
Gene: ENSMUSG00000005373
AA Change: F381S

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1am9a_ 658 696 1e-5 SMART
Blast:HLH 667 698 2e-12 BLAST
low complexity region 728 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154840
SMART Domains Protein: ENSMUSP00000121668
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
HLH 26 120 7.9e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glycolysis and lipogenesis and severe simple carbohydrate intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Mlxipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Mlxipl APN 5 135132778 missense probably damaging 0.98
IGL01872:Mlxipl APN 5 135113691 missense probably damaging 1.00
IGL02694:Mlxipl APN 5 135124018 critical splice donor site probably null
IGL03070:Mlxipl APN 5 135132453 missense possibly damaging 0.93
Scarlet UTSW 5 135134030 missense possibly damaging 0.93
H8441:Mlxipl UTSW 5 135123961 missense probably damaging 1.00
IGL03054:Mlxipl UTSW 5 135133256 missense possibly damaging 0.83
R0003:Mlxipl UTSW 5 135133189 unclassified probably benign
R0126:Mlxipl UTSW 5 135132323 missense probably damaging 0.96
R0458:Mlxipl UTSW 5 135133370 missense probably benign 0.33
R0513:Mlxipl UTSW 5 135137263 missense probably benign 0.33
R0580:Mlxipl UTSW 5 135123975 missense probably benign 0.01
R0744:Mlxipl UTSW 5 135132475 missense possibly damaging 0.86
R0827:Mlxipl UTSW 5 135132738 missense probably benign 0.00
R1052:Mlxipl UTSW 5 135113710 missense probably damaging 1.00
R1241:Mlxipl UTSW 5 135132718 missense probably benign 0.01
R1795:Mlxipl UTSW 5 135107170 missense probably damaging 1.00
R1903:Mlxipl UTSW 5 135133568 missense possibly damaging 0.92
R2038:Mlxipl UTSW 5 135106999 missense probably damaging 1.00
R2064:Mlxipl UTSW 5 135132777 missense possibly damaging 0.77
R2069:Mlxipl UTSW 5 135107005 missense probably damaging 1.00
R2081:Mlxipl UTSW 5 135113638 missense probably damaging 1.00
R2095:Mlxipl UTSW 5 135122120 splice site probably benign
R3114:Mlxipl UTSW 5 135133662 splice site probably benign
R4018:Mlxipl UTSW 5 135132672 missense probably damaging 1.00
R4090:Mlxipl UTSW 5 135132527 missense probably benign 0.33
R4321:Mlxipl UTSW 5 135135450 nonsense probably null
R4414:Mlxipl UTSW 5 135137399 unclassified probably benign
R5706:Mlxipl UTSW 5 135133604 missense probably benign 0.33
R6088:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R6508:Mlxipl UTSW 5 135128620 missense probably benign 0.03
R6704:Mlxipl UTSW 5 135137240 critical splice acceptor site probably null
R7060:Mlxipl UTSW 5 135132315 missense possibly damaging 0.88
R7095:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R7128:Mlxipl UTSW 5 135133851 missense probably damaging 0.98
R7464:Mlxipl UTSW 5 135133628 missense probably benign 0.01
R7510:Mlxipl UTSW 5 135133118 missense possibly damaging 0.72
R7737:Mlxipl UTSW 5 135135381 missense possibly damaging 0.73
R7806:Mlxipl UTSW 5 135134543 missense possibly damaging 0.93
R7910:Mlxipl UTSW 5 135132409 missense possibly damaging 0.85
R7991:Mlxipl UTSW 5 135132409 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGGATCAGTTCTCATCTATACCCAG -3'
(R):5'- AGGAAGCGTAGACACTCCTG -3'

Sequencing Primer
(F):5'- CAGTCCAATACATAGCCAGGATAGAG -3'
(R):5'- CGTAGACACTCCTGGAGCAG -3'
Posted On2019-11-12