Incidental Mutation 'R7669:Aldh1l1'
ID592042
Institutional Source Beutler Lab
Gene Symbol Aldh1l1
Ensembl Gene ENSMUSG00000030088
Gene Namealdehyde dehydrogenase 1 family, member L1
SynonymsFthfd, 1810048F20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location90486427-90600203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90570862 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 435 (G435S)
Ref Sequence ENSEMBL: ENSMUSP00000032175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032175] [ENSMUST00000130418] [ENSMUST00000204796]
Predicted Effect probably benign
Transcript: ENSMUST00000032175
AA Change: G435S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032175
Gene: ENSMUSG00000030088
AA Change: G435S

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 6.9e-53 PFAM
Pfam:Formyl_trans_C 204 310 4e-18 PFAM
Pfam:PP-binding 325 391 3.7e-6 PFAM
Pfam:Aldedh 430 898 1.3e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130418
AA Change: G435S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114304
Gene: ENSMUSG00000030088
AA Change: G435S

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 7.4e-54 PFAM
Pfam:Formyl_trans_C 204 310 2.6e-18 PFAM
Pfam:Aldedh 430 898 1.7e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204796
SMART Domains Protein: ENSMUSP00000145380
Gene: ENSMUSG00000030088

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 3e-53 PFAM
Pfam:Formyl_trans_C 204 310 1.5e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Aldh1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Aldh1l1 APN 6 90598380 missense probably damaging 1.00
IGL01350:Aldh1l1 APN 6 90559356 missense probably damaging 1.00
IGL01601:Aldh1l1 APN 6 90591841 missense probably damaging 1.00
IGL01686:Aldh1l1 APN 6 90559233 splice site probably benign
IGL01868:Aldh1l1 APN 6 90583230 nonsense probably null
IGL01941:Aldh1l1 APN 6 90562695 missense probably damaging 0.98
IGL01982:Aldh1l1 APN 6 90559863 missense probably benign 0.00
IGL02088:Aldh1l1 APN 6 90580590 splice site probably benign
IGL02159:Aldh1l1 APN 6 90594656 splice site probably benign
IGL02450:Aldh1l1 APN 6 90569873 missense probably benign 0.00
IGL02657:Aldh1l1 APN 6 90590794 missense probably damaging 1.00
IGL02839:Aldh1l1 APN 6 90569875 missense possibly damaging 0.95
R0149:Aldh1l1 UTSW 6 90589414 missense possibly damaging 0.85
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0418:Aldh1l1 UTSW 6 90569893 missense possibly damaging 0.49
R1121:Aldh1l1 UTSW 6 90589384 missense probably benign
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1649:Aldh1l1 UTSW 6 90564389 missense probably benign
R1793:Aldh1l1 UTSW 6 90577831 missense possibly damaging 0.92
R2043:Aldh1l1 UTSW 6 90557332 missense probably benign 0.05
R2044:Aldh1l1 UTSW 6 90562665 missense probably benign 0.00
R2229:Aldh1l1 UTSW 6 90583186 missense probably damaging 1.00
R2426:Aldh1l1 UTSW 6 90598284 missense probably damaging 0.99
R4109:Aldh1l1 UTSW 6 90562644 missense probably benign 0.04
R4818:Aldh1l1 UTSW 6 90596915 missense probably benign
R5214:Aldh1l1 UTSW 6 90563417 missense probably damaging 1.00
R5285:Aldh1l1 UTSW 6 90576770 nonsense probably null
R5426:Aldh1l1 UTSW 6 90559299 missense probably benign
R5516:Aldh1l1 UTSW 6 90596945 missense possibly damaging 0.95
R5970:Aldh1l1 UTSW 6 90597046 intron probably benign
R6235:Aldh1l1 UTSW 6 90564457 missense probably benign 0.44
R6322:Aldh1l1 UTSW 6 90562698 missense probably benign 0.03
R7053:Aldh1l1 UTSW 6 90563438 missense possibly damaging 0.50
R7125:Aldh1l1 UTSW 6 90576779 critical splice donor site probably null
R7128:Aldh1l1 UTSW 6 90563379 missense probably benign 0.23
R7142:Aldh1l1 UTSW 6 90563416 missense probably damaging 1.00
R7203:Aldh1l1 UTSW 6 90570800 missense probably benign 0.01
R7205:Aldh1l1 UTSW 6 90598275 missense probably damaging 0.97
R7477:Aldh1l1 UTSW 6 90598387 critical splice donor site probably null
R7718:Aldh1l1 UTSW 6 90598323 missense probably damaging 1.00
R7788:Aldh1l1 UTSW 6 90569912 missense probably benign 0.20
RF007:Aldh1l1 UTSW 6 90598259 missense probably damaging 0.99
Z1176:Aldh1l1 UTSW 6 90557284 frame shift probably null
Z1176:Aldh1l1 UTSW 6 90583173 missense probably benign 0.11
Z1177:Aldh1l1 UTSW 6 90564449 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCTGTGAGTCTCTGGACG -3'
(R):5'- AGATTCTGCTTCCTGGGTGC -3'

Sequencing Primer
(F):5'- CTCTGGACGTGCATGATATCACATG -3'
(R):5'- ATCAGCTTGCTCTACTCCAC -3'
Posted On2019-11-12