Incidental Mutation 'R7669:Gria4'
ID 592047
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Name glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms Glur-4, spkw1, Gluralpha4, Glur4
MMRRC Submission 045741-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.690) question?
Stock # R7669 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 4417896-4796234 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4462029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 641 (N641K)
Ref Sequence ENSEMBL: ENSMUSP00000066980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect probably damaging
Transcript: ENSMUST00000027020
AA Change: N641K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: N641K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063508
AA Change: N641K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: N641K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212533
AA Change: N641K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,831,221 (GRCm39) P930S probably benign Het
Ada T A 2: 163,570,111 (GRCm39) K301* probably null Het
Alb T C 5: 90,611,850 (GRCm39) L93P possibly damaging Het
Aldh1l1 G A 6: 90,547,844 (GRCm39) G435S probably benign Het
Alox12b A T 11: 69,060,167 (GRCm39) I627F probably benign Het
Aloxe3 A G 11: 69,025,946 (GRCm39) I503V probably benign Het
Arhgap29 C T 3: 121,786,461 (GRCm39) A342V probably damaging Het
BC024139 G A 15: 76,004,768 (GRCm39) P636L possibly damaging Het
Bmp6 G T 13: 38,668,896 (GRCm39) R293L probably damaging Het
Cfd G A 10: 79,727,447 (GRCm39) probably null Het
Csmd1 C T 8: 15,967,273 (GRCm39) A3197T probably damaging Het
Flii G A 11: 60,613,490 (GRCm39) L166F probably damaging Het
Fmn1 T A 2: 113,195,822 (GRCm39) N507K unknown Het
Foxe1 C A 4: 46,344,545 (GRCm39) R118S possibly damaging Het
Fras1 T C 5: 96,840,483 (GRCm39) V1646A probably benign Het
Gm14496 A G 2: 181,637,711 (GRCm39) T262A possibly damaging Het
Gpbp1 A T 13: 111,575,658 (GRCm39) S282T probably benign Het
Grin2a T G 16: 9,810,327 (GRCm39) N24T probably benign Het
Gstm2 T G 3: 107,892,992 (GRCm39) D40A probably benign Het
Heatr1 T A 13: 12,426,143 (GRCm39) I657N probably benign Het
Kmt2b T C 7: 30,282,656 (GRCm39) E1102G possibly damaging Het
Macroh2a1 T C 13: 56,276,146 (GRCm39) Y39C probably damaging Het
Mgam T A 6: 40,635,944 (GRCm39) N366K probably benign Het
Mier2 A T 10: 79,385,510 (GRCm39) V35E probably damaging Het
Mlxipl T C 5: 135,161,224 (GRCm39) F381S possibly damaging Het
Mroh1 A G 15: 76,336,048 (GRCm39) H1474R possibly damaging Het
Mtrf1l G T 10: 5,765,620 (GRCm39) A239E probably damaging Het
Nbea G T 3: 55,625,200 (GRCm39) A2297E probably damaging Het
Nectin4 A G 1: 171,207,827 (GRCm39) E73G probably benign Het
Neurl1b C G 17: 26,657,720 (GRCm39) H219Q probably benign Het
Nfia G A 4: 97,671,742 (GRCm39) V151I probably damaging Het
Nol6 A G 4: 41,118,717 (GRCm39) L720P probably damaging Het
Or6c203 A G 10: 129,010,128 (GRCm39) F254S probably damaging Het
Or7e165 A G 9: 19,694,839 (GRCm39) N137D possibly damaging Het
Patj A G 4: 98,407,179 (GRCm39) E1054G probably damaging Het
Pcnx1 A G 12: 82,037,325 (GRCm39) D1861G probably damaging Het
Prss12 A G 3: 123,241,045 (GRCm39) T80A probably benign Het
Scart2 A G 7: 139,876,234 (GRCm39) S569G possibly damaging Het
Sgsm1 C A 5: 113,400,890 (GRCm39) R1000L probably damaging Het
Sulf2 T C 2: 165,935,516 (GRCm39) D199G possibly damaging Het
Suox T C 10: 128,506,780 (GRCm39) D416G probably benign Het
Syne1 G A 10: 5,011,531 (GRCm39) T38M probably damaging Het
Tcf7l2 T A 19: 55,912,975 (GRCm39) C421* probably null Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Traf7 C A 17: 24,732,282 (GRCm39) G143* probably null Het
Trappc12 T C 12: 28,761,957 (GRCm39) I544V probably benign Het
Trmt1 G A 8: 85,424,180 (GRCm39) V434I probably benign Het
Ttc5 T C 14: 51,014,787 (GRCm39) H160R probably benign Het
Xirp2 T A 2: 67,342,521 (GRCm39) H1587Q probably benign Het
Zfp523 C T 17: 28,420,015 (GRCm39) T220M probably damaging Het
Zfp804b A T 5: 6,819,362 (GRCm39) S1234T probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4,472,202 (GRCm39) missense probably damaging 0.98
IGL01451:Gria4 APN 9 4,503,652 (GRCm39) missense probably benign 0.04
IGL01533:Gria4 APN 9 4,502,395 (GRCm39) missense probably damaging 1.00
IGL01994:Gria4 APN 9 4,537,726 (GRCm39) missense probably damaging 1.00
IGL02078:Gria4 APN 9 4,793,878 (GRCm39) missense probably damaging 0.98
IGL02183:Gria4 APN 9 4,502,460 (GRCm39) missense probably damaging 1.00
IGL02351:Gria4 APN 9 4,456,206 (GRCm39) missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4,456,206 (GRCm39) missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4,793,804 (GRCm39) splice site probably benign
IGL03131:Gria4 APN 9 4,432,876 (GRCm39) missense probably damaging 0.96
IGL03148:Gria4 APN 9 4,464,295 (GRCm39) missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4,513,288 (GRCm39) missense probably benign
PIT4812001:Gria4 UTSW 9 4,427,128 (GRCm39) missense probably damaging 1.00
R0018:Gria4 UTSW 9 4,432,843 (GRCm39) missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4,793,840 (GRCm39) missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4,464,372 (GRCm39) missense probably benign 0.32
R0690:Gria4 UTSW 9 4,427,071 (GRCm39) missense probably damaging 1.00
R0992:Gria4 UTSW 9 4,795,238 (GRCm39) missense probably benign
R1517:Gria4 UTSW 9 4,793,865 (GRCm39) missense probably damaging 1.00
R1673:Gria4 UTSW 9 4,537,637 (GRCm39) nonsense probably null
R1713:Gria4 UTSW 9 4,424,448 (GRCm39) missense probably benign 0.20
R1961:Gria4 UTSW 9 4,519,546 (GRCm39) splice site probably benign
R2137:Gria4 UTSW 9 4,427,026 (GRCm39) intron probably benign
R2397:Gria4 UTSW 9 4,537,717 (GRCm39) missense probably damaging 1.00
R2870:Gria4 UTSW 9 4,503,614 (GRCm39) missense probably damaging 0.96
R2870:Gria4 UTSW 9 4,503,614 (GRCm39) missense probably damaging 0.96
R3014:Gria4 UTSW 9 4,464,294 (GRCm39) missense probably damaging 0.97
R3412:Gria4 UTSW 9 4,513,278 (GRCm39) missense probably benign 0.00
R3732:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3732:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3733:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3897:Gria4 UTSW 9 4,513,260 (GRCm39) missense probably damaging 1.00
R4404:Gria4 UTSW 9 4,464,489 (GRCm39) splice site probably null
R4457:Gria4 UTSW 9 4,427,074 (GRCm39) missense probably damaging 1.00
R4672:Gria4 UTSW 9 4,664,981 (GRCm39) missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4,464,295 (GRCm39) missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4,472,176 (GRCm39) missense probably benign 0.01
R5109:Gria4 UTSW 9 4,472,168 (GRCm39) missense probably damaging 1.00
R5202:Gria4 UTSW 9 4,424,330 (GRCm39) missense probably benign 0.10
R5828:Gria4 UTSW 9 4,432,832 (GRCm39) missense probably damaging 1.00
R5945:Gria4 UTSW 9 4,456,122 (GRCm39) missense probably damaging 1.00
R5985:Gria4 UTSW 9 4,503,593 (GRCm39) missense probably damaging 0.99
R6036:Gria4 UTSW 9 4,537,646 (GRCm39) missense probably benign 0.00
R6036:Gria4 UTSW 9 4,537,646 (GRCm39) missense probably benign 0.00
R6111:Gria4 UTSW 9 4,502,430 (GRCm39) missense probably damaging 1.00
R6190:Gria4 UTSW 9 4,420,199 (GRCm39) missense probably benign
R6280:Gria4 UTSW 9 4,456,072 (GRCm39) missense probably damaging 1.00
R6406:Gria4 UTSW 9 4,427,077 (GRCm39) missense probably damaging 1.00
R6470:Gria4 UTSW 9 4,503,680 (GRCm39) missense probably damaging 1.00
R6485:Gria4 UTSW 9 4,464,249 (GRCm39) missense probably damaging 1.00
R6612:Gria4 UTSW 9 4,472,206 (GRCm39) missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4,793,822 (GRCm39) missense probably damaging 1.00
R7046:Gria4 UTSW 9 4,420,278 (GRCm39) missense probably damaging 0.97
R7210:Gria4 UTSW 9 4,464,135 (GRCm39) missense probably damaging 1.00
R7284:Gria4 UTSW 9 4,472,017 (GRCm39) missense probably damaging 1.00
R7475:Gria4 UTSW 9 4,513,330 (GRCm39) missense probably damaging 1.00
R7501:Gria4 UTSW 9 4,502,436 (GRCm39) missense probably benign 0.01
R7536:Gria4 UTSW 9 4,464,298 (GRCm39) missense probably damaging 1.00
R7604:Gria4 UTSW 9 4,464,315 (GRCm39) missense probably damaging 1.00
R7643:Gria4 UTSW 9 4,793,950 (GRCm39) missense probably benign 0.00
R7703:Gria4 UTSW 9 4,503,588 (GRCm39) missense probably benign
R7720:Gria4 UTSW 9 4,464,288 (GRCm39) missense probably damaging 1.00
R7724:Gria4 UTSW 9 4,472,074 (GRCm39) missense probably damaging 1.00
R7909:Gria4 UTSW 9 4,464,450 (GRCm39) missense probably damaging 1.00
R8007:Gria4 UTSW 9 4,503,740 (GRCm39) splice site probably benign
R8044:Gria4 UTSW 9 4,456,216 (GRCm39) missense probably damaging 1.00
R8062:Gria4 UTSW 9 4,480,273 (GRCm39) missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4,502,429 (GRCm39) missense probably benign 0.16
R8212:Gria4 UTSW 9 4,480,242 (GRCm39) missense probably benign
R8478:Gria4 UTSW 9 4,793,882 (GRCm39) missense probably damaging 1.00
R8699:Gria4 UTSW 9 4,424,351 (GRCm39) missense probably damaging 1.00
R8699:Gria4 UTSW 9 4,424,347 (GRCm39) missense probably damaging 1.00
R8785:Gria4 UTSW 9 4,795,189 (GRCm39) missense possibly damaging 0.92
R8785:Gria4 UTSW 9 4,456,106 (GRCm39) missense probably damaging 1.00
R8888:Gria4 UTSW 9 4,664,951 (GRCm39) missense probably damaging 1.00
R8895:Gria4 UTSW 9 4,664,951 (GRCm39) missense probably damaging 1.00
R9160:Gria4 UTSW 9 4,424,412 (GRCm39) missense probably damaging 1.00
R9498:Gria4 UTSW 9 4,503,560 (GRCm39) critical splice donor site probably null
R9743:Gria4 UTSW 9 4,464,457 (GRCm39) missense probably damaging 1.00
X0023:Gria4 UTSW 9 4,427,067 (GRCm39) missense probably damaging 1.00
X0065:Gria4 UTSW 9 4,464,340 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CTGTCACAAACGTTGTCCAG -3'
(R):5'- AGGAAAGTTTCACATTTCTGCC -3'

Sequencing Primer
(F):5'- CTGTCACAAACGTTGTCCAGAATTC -3'
(R):5'- GTCTTCAGTGACACTTGCATTTTAG -3'
Posted On 2019-11-12