Incidental Mutation 'R7669:Mtrf1l'
ID592050
Institutional Source Beutler Lab
Gene Symbol Mtrf1l
Ensembl Gene ENSMUSG00000019774
Gene Namemitochondrial translational release factor 1-like
Synonyms9130004K12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location5811887-5823910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5815620 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 239 (A239E)
Ref Sequence ENSEMBL: ENSMUSP00000019908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019908]
Predicted Effect probably damaging
Transcript: ENSMUST00000019908
AA Change: A239E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019908
Gene: ENSMUSG00000019774
AA Change: A239E

DomainStartEndE-ValueType
PCRF 75 189 2.26e-36 SMART
Pfam:RF-1 221 331 1.5e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. This protein acts upon UAA and UAG stop codons, but has no in vitro activity against UGA, which encodes tryptophan in human mitochondrion, or, the mitochondrial non-cognate stop codons, AGA and AGG. This protein shares sequence similarity to bacterial release factors. Pseudogenes of this gene are found on chromosomes 4, 8, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Mtrf1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Mtrf1l APN 10 5814180 splice site probably benign
IGL01292:Mtrf1l APN 10 5814090 missense probably benign 0.00
IGL01844:Mtrf1l APN 10 5814112 missense probably null 0.76
R0050:Mtrf1l UTSW 10 5815553 splice site silent
R0051:Mtrf1l UTSW 10 5813382 missense probably damaging 1.00
R0051:Mtrf1l UTSW 10 5813384 missense probably damaging 1.00
R0866:Mtrf1l UTSW 10 5813376 missense probably damaging 1.00
R1636:Mtrf1l UTSW 10 5813265 missense probably damaging 0.98
R2897:Mtrf1l UTSW 10 5817565 missense probably benign 0.16
R4020:Mtrf1l UTSW 10 5817454 missense probably benign 0.01
R4618:Mtrf1l UTSW 10 5817586 missense probably benign 0.37
R4843:Mtrf1l UTSW 10 5823696 missense possibly damaging 0.56
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6261:Mtrf1l UTSW 10 5815550 critical splice donor site probably null
R6345:Mtrf1l UTSW 10 5817468 missense possibly damaging 0.96
R6991:Mtrf1l UTSW 10 5813384 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTCGTTAGTTAGTTACGAGC -3'
(R):5'- TCTACCAGTGGTCTATTCTTAAACC -3'

Sequencing Primer
(F):5'- CGTTAGTTAGTTACGAGCTCTTAATG -3'
(R):5'- CAGTGGTCTATTCTTAAACCTTTCAG -3'
Posted On2019-11-12