Incidental Mutation 'R7669:Mier2'
ID592051
Institutional Source Beutler Lab
Gene Symbol Mier2
Ensembl Gene ENSMUSG00000042570
Gene NameMIER family member 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79540245-79555199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79549676 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 35 (V35E)
Ref Sequence ENSEMBL: ENSMUSP00000127387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062855] [ENSMUST00000164895] [ENSMUST00000165028] [ENSMUST00000165778] [ENSMUST00000165866] [ENSMUST00000167183] [ENSMUST00000167689] [ENSMUST00000170018]
Predicted Effect probably damaging
Transcript: ENSMUST00000062855
AA Change: V35E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059864
Gene: ENSMUSG00000042570
AA Change: V35E

DomainStartEndE-ValueType
ELM2 194 246 1.46e-9 SMART
SANT 295 344 6.01e-8 SMART
low complexity region 441 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164895
Predicted Effect probably damaging
Transcript: ENSMUST00000165028
AA Change: V35E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127387
Gene: ENSMUSG00000042570
AA Change: V35E

DomainStartEndE-ValueType
ELM2 196 248 1.46e-9 SMART
SANT 297 346 6.01e-8 SMART
low complexity region 443 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165778
Predicted Effect probably damaging
Transcript: ENSMUST00000165866
AA Change: V106E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127332
Gene: ENSMUSG00000042570
AA Change: V106E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 42 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167183
Predicted Effect probably benign
Transcript: ENSMUST00000167689
Predicted Effect probably damaging
Transcript: ENSMUST00000170018
AA Change: V48E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Mier2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Mier2 APN 10 79541180 makesense probably null
IGL01761:Mier2 APN 10 79548352 critical splice donor site probably null
IGL01845:Mier2 APN 10 79549584 missense possibly damaging 0.69
IGL02336:Mier2 APN 10 79548350 unclassified probably benign
IGL02882:Mier2 APN 10 79547721 missense probably damaging 1.00
IGL02902:Mier2 APN 10 79549622 missense probably damaging 1.00
R0325:Mier2 UTSW 10 79542596 critical splice donor site probably null
R0972:Mier2 UTSW 10 79544621 unclassified probably benign
R1326:Mier2 UTSW 10 79544709 missense probably damaging 1.00
R1333:Mier2 UTSW 10 79545157 missense probably benign 0.03
R1721:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1867:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1868:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R2015:Mier2 UTSW 10 79541202 splice site probably null
R2273:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R2274:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R3729:Mier2 UTSW 10 79545042 unclassified probably benign
R3874:Mier2 UTSW 10 79541797 missense possibly damaging 0.49
R3881:Mier2 UTSW 10 79548750 unclassified probably null
R4755:Mier2 UTSW 10 79549197 missense probably damaging 1.00
R4758:Mier2 UTSW 10 79550348 missense probably damaging 1.00
R5070:Mier2 UTSW 10 79549577 missense probably benign 0.03
R6282:Mier2 UTSW 10 79544742 missense probably damaging 1.00
R6785:Mier2 UTSW 10 79544713 missense probably damaging 1.00
R6861:Mier2 UTSW 10 79541156 start gained probably benign
R6869:Mier2 UTSW 10 79542669 missense probably damaging 0.99
R6897:Mier2 UTSW 10 79544739 missense probably damaging 0.99
R6902:Mier2 UTSW 10 79540839 utr 3 prime probably benign
R6946:Mier2 UTSW 10 79540839 utr 3 prime probably benign
R6968:Mier2 UTSW 10 79540642 utr 3 prime probably benign
R6971:Mier2 UTSW 10 79542429 missense possibly damaging 0.53
R7072:Mier2 UTSW 10 79540299 missense unknown
R7350:Mier2 UTSW 10 79540298 missense unknown
R7443:Mier2 UTSW 10 79540455 missense unknown
R7506:Mier2 UTSW 10 79550342 missense probably benign 0.14
R7545:Mier2 UTSW 10 79541194 missense possibly damaging 0.79
R7625:Mier2 UTSW 10 79542709 missense probably damaging 1.00
R7895:Mier2 UTSW 10 79541885 start gained probably benign
R7978:Mier2 UTSW 10 79541885 start gained probably benign
Z1176:Mier2 UTSW 10 79540501 missense unknown
Z1177:Mier2 UTSW 10 79540461 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGACAGTACACCAAAGCTC -3'
(R):5'- AGGCTTAATGTCCTTCTAGATCCATC -3'

Sequencing Primer
(F):5'- TCTCAGGAACAGAGCAGGCTC -3'
(R):5'- AGATCCATCTGTTCCTGCCCAG -3'
Posted On2019-11-12