Incidental Mutation 'R7669:Cfd'
ID592052
Institutional Source Beutler Lab
Gene Symbol Cfd
Ensembl Gene ENSMUSG00000061780
Gene Namecomplement factor D (adipsin)
Synonymsfactor D, D component (adipsin) of complement, Adn, DF
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7669 (G1)
Quality Score184.009
Status Not validated
Chromosome10
Chromosomal Location79890853-79892655 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 79891613 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046091] [ENSMUST00000061653] [ENSMUST00000105378] [ENSMUST00000165684] [ENSMUST00000217837]
Predicted Effect probably benign
Transcript: ENSMUST00000046091
SMART Domains Protein: ENSMUSP00000038925
Gene: ENSMUSG00000020125

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 242 3.74e-74 SMART
Predicted Effect probably null
Transcript: ENSMUST00000061653
SMART Domains Protein: ENSMUSP00000056836
Gene: ENSMUSG00000061780

DomainStartEndE-ValueType
Tryp_SPc 25 249 8.25e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105378
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165684
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217837
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the alternative pathway of complement activation for pathogen recognition and elimination. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional enzyme that in turn cleaves factor B in the complement pathway. This gene is expressed in adipocytes and the mature enzyme is secreted into the bloodstream. Mice lacking the encoded product cannot initiate alternative pathway of complement activation. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show impaired complement activation by alternative pathway activators, and increased susceptibility to pneumococcal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Cfd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Cfd APN 10 79890942 missense probably benign
R0325:Cfd UTSW 10 79891758 nonsense probably null
R1376:Cfd UTSW 10 79892152 missense possibly damaging 0.89
R1376:Cfd UTSW 10 79892152 missense possibly damaging 0.89
R1708:Cfd UTSW 10 79891607 missense probably benign 0.00
R2221:Cfd UTSW 10 79892205 unclassified probably null
R2223:Cfd UTSW 10 79892205 unclassified probably null
R4823:Cfd UTSW 10 79890948 missense probably benign
R5388:Cfd UTSW 10 79892125 missense probably damaging 1.00
R6687:Cfd UTSW 10 79891719 missense probably damaging 0.99
R6733:Cfd UTSW 10 79891802 missense probably damaging 1.00
R7085:Cfd UTSW 10 79892492 missense probably damaging 1.00
R7123:Cfd UTSW 10 79892497 missense probably damaging 1.00
R7451:Cfd UTSW 10 79891528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTCTCTTTAGGTGCAACC -3'
(R):5'- TGAGGCACTACACTCTGCAC -3'

Sequencing Primer
(F):5'- TTACAATACACCTACCCTCCTCAG -3'
(R):5'- ACATCATACCATCGCTTGTAGGG -3'
Posted On2019-11-12