Incidental Mutation 'R7669:Suox'
ID592053
Institutional Source Beutler Lab
Gene Symbol Suox
Ensembl Gene ENSMUSG00000049858
Gene Namesulfite oxidase
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128669894-128674073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128670911 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 416 (D416G)
Ref Sequence ENSEMBL: ENSMUSP00000056195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054764]
Predicted Effect probably benign
Transcript: ENSMUST00000054764
AA Change: D416G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000056195
Gene: ENSMUSG00000049858
AA Change: D416G

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Cyt-b5 86 162 3.41e-13 SMART
Pfam:Oxidored_molyb 220 396 1.2e-62 PFAM
Pfam:Mo-co_dimer 418 545 1.7e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfite oxidase is a homodimeric protein localized to the intermembrane space of mitochondria. Each subunit contains a heme domain and a molybdopterin-binding domain. The enzyme catalyzes the oxidation of sulfite to sulfate, the final reaction in the oxidative degradation of the sulfur amino acids cysteine and methionine. Sulfite oxidase deficiency results in neurological abnormalities which are often fatal at an early age. Alternative splicing results in multiple transcript variants encoding identical proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Suox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Suox APN 10 128672098 splice site probably benign
IGL02744:Suox APN 10 128671217 missense probably benign 0.00
PIT4402001:Suox UTSW 10 128671295 missense probably damaging 1.00
R0414:Suox UTSW 10 128671457 missense probably benign 0.01
R0418:Suox UTSW 10 128670885 missense probably damaging 1.00
R0612:Suox UTSW 10 128670656 missense probably benign
R1845:Suox UTSW 10 128670539 missense possibly damaging 0.56
R3976:Suox UTSW 10 128671037 missense probably damaging 0.96
R4808:Suox UTSW 10 128671889 missense possibly damaging 0.81
R5098:Suox UTSW 10 128671158 missense probably damaging 1.00
R5587:Suox UTSW 10 128671825 missense probably damaging 1.00
R5721:Suox UTSW 10 128671293 missense possibly damaging 0.55
R6968:Suox UTSW 10 128671833 missense possibly damaging 0.92
R7378:Suox UTSW 10 128671041 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGCTTTCAACTGCCATATTC -3'
(R):5'- TGACCATGGCTTCCCTGTAC -3'

Sequencing Primer
(F):5'- TTCAACTGCCATATTCGCCAAG -3'
(R):5'- CCTGTACGGGTGGTGGTTCC -3'
Posted On2019-11-12