Incidental Mutation 'R7669:Olfr772'
ID592054
Institutional Source Beutler Lab
Gene Symbol Olfr772
Ensembl Gene ENSMUSG00000107662
Gene Nameolfactory receptor 772
SynonymsMOR114-3, GA_x6K02T2PULF-10860457-10859522
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129172573-129177921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129174259 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 254 (F254S)
Ref Sequence ENSEMBL: ENSMUSP00000148854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169800] [ENSMUST00000214672]
Predicted Effect probably damaging
Transcript: ENSMUST00000169800
AA Change: F254S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132389
Gene: ENSMUSG00000107662
AA Change: F254S

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.6e-47 PFAM
Pfam:7tm_1 38 287 1.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214672
AA Change: F254S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Olfr772
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02512:Olfr772 APN 10 129174250 missense possibly damaging 0.65
IGL03072:Olfr772 APN 10 129174489 missense probably damaging 1.00
IGL03336:Olfr772 APN 10 129174229 missense probably benign 0.00
R1852:Olfr772 UTSW 10 129174328 missense probably benign 0.00
R2496:Olfr772 UTSW 10 129174097 missense probably benign 0.00
R6031:Olfr772 UTSW 10 129174355 missense probably benign 0.14
R6031:Olfr772 UTSW 10 129174355 missense probably benign 0.14
R6168:Olfr772 UTSW 10 129174166 missense probably damaging 1.00
R7454:Olfr772 UTSW 10 129174455 missense probably damaging 1.00
R7905:Olfr772 UTSW 10 129174187 missense probably damaging 0.99
R7988:Olfr772 UTSW 10 129174187 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCAACTGGACCCAGAAGTTTGG -3'
(R):5'- TGGAGCAGACAGTTCTCATCTG -3'

Sequencing Primer
(F):5'- CCAGAAGTTTGGGAAGTTTAATCC -3'
(R):5'- AGCAGACAGTTCTCATCTGTGCTG -3'
Posted On2019-11-12