Incidental Mutation 'R7669:Aloxe3'
ID592056
Institutional Source Beutler Lab
Gene Symbol Aloxe3
Ensembl Gene ENSMUSG00000020892
Gene Namearachidonate lipoxygenase 3
Synonymse-LOX-3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69125896-69149115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69135120 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 503 (I503V)
Ref Sequence ENSEMBL: ENSMUSP00000021268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021268] [ENSMUST00000175661]
Predicted Effect probably benign
Transcript: ENSMUST00000021268
AA Change: I503V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021268
Gene: ENSMUSG00000020892
AA Change: I503V

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 249 697 3.4e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175661
SMART Domains Protein: ENSMUSP00000134814
Gene: ENSMUSG00000020892

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 245 377 7.6e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoxygenase family, which are catabolized by arachidonic acid-derived compounds. The encoded enzyme is a hydroperoxide isomerase that synthesizes a unique type of epoxy alcohol (8R-hydroxy-11R,12R-epoxyeicosa-5Z,9E,14Z-trienoic acid) from 12R-hydroperoxyeicosatetraenoic acid (12R-HPETE). This epoxy alcohol can activate the the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha), which is implicated in epidermal differentiation. Loss of function of the enzyme encoded by this gene results in ichthyosis, implicating the function of this gene in the differentiation of human skin. This gene is part of a cluster of lipoxygenase genes on 17p13.1. Mutations in this gene result in nonbullous congenital ichthyosiform erythroderma (NCIE). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality, imapired skin barrier function, dehydration, tightly packed stratum corneum, impaired stratum corneum desquamation and reduced levels of ester-bound ceramide in the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Aloxe3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Aloxe3 APN 11 69130013 missense probably benign 0.41
IGL01925:Aloxe3 APN 11 69128633 missense probably damaging 1.00
IGL01947:Aloxe3 APN 11 69143021 splice site probably benign
IGL02421:Aloxe3 APN 11 69130046 missense possibly damaging 0.87
IGL03206:Aloxe3 APN 11 69129646 missense possibly damaging 0.74
IGL03054:Aloxe3 UTSW 11 69129607 missense possibly damaging 0.78
R1613:Aloxe3 UTSW 11 69130046 missense possibly damaging 0.87
R1757:Aloxe3 UTSW 11 69135949 missense possibly damaging 0.72
R1839:Aloxe3 UTSW 11 69130085 missense probably damaging 1.00
R2182:Aloxe3 UTSW 11 69129600 missense possibly damaging 0.93
R2912:Aloxe3 UTSW 11 69130040 missense probably damaging 1.00
R2919:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R2920:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R4731:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5245:Aloxe3 UTSW 11 69129676 missense probably benign 0.00
R5459:Aloxe3 UTSW 11 69132828 missense possibly damaging 0.66
R5493:Aloxe3 UTSW 11 69128617 nonsense probably null
R5725:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5755:Aloxe3 UTSW 11 69132749 missense probably benign 0.04
R5789:Aloxe3 UTSW 11 69126439 missense probably damaging 1.00
R7343:Aloxe3 UTSW 11 69132743 missense probably benign 0.00
R7419:Aloxe3 UTSW 11 69127527 missense probably benign 0.00
R7451:Aloxe3 UTSW 11 69142920 missense possibly damaging 0.90
X0019:Aloxe3 UTSW 11 69148735 missense probably damaging 1.00
X0020:Aloxe3 UTSW 11 69133027 critical splice acceptor site probably null
Z1176:Aloxe3 UTSW 11 69133079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTTTCAGTTGGTCTCCAGGC -3'
(R):5'- TGTCTGCCAGTTCCTATTTGAG -3'

Sequencing Primer
(F):5'- CAGTTGGTCTCCAGGCACTATAG -3'
(R):5'- GTTTCTTAAACTGGATGGAGTCAAG -3'
Posted On2019-11-12