Mutagenetix > Incidental Mutation

Incidental Mutation 'R7669:Aloxe3'

592056

Institutional Source

Beutler Lab

Gene Symbol

Aloxe3

Ensembl Gene

ENSMUSG00000020892

Gene Name

arachidonate lipoxygenase 3

Synonyms

e-LOX-3

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7669 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69125896-69149115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69135120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 503 (I503V)

Ref Sequence

ENSEMBL: ENSMUSP00000021268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021268] [ENSMUST00000175661]

AlphaFold

Q9WV07

Predicted Effect

probably benign
Transcript: ENSMUST00000021268
AA Change: I503V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000021268
Gene: ENSMUSG00000020892
AA Change: I503V

Domain	Start	End	E-Value	Type
LH2	2	116	1.93e-20	SMART
Pfam:Lipoxygenase	249	697	3.4e-76	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175661

SMART Domains

Protein: ENSMUSP00000134814
Gene: ENSMUSG00000020892

Domain	Start	End	E-Value	Type
LH2	2	116	1.93e-20	SMART
Pfam:Lipoxygenase	245	377	7.6e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoxygenase family, which are catabolized by arachidonic acid-derived compounds. The encoded enzyme is a hydroperoxide isomerase that synthesizes a unique type of epoxy alcohol (8R-hydroxy-11R,12R-epoxyeicosa-5Z,9E,14Z-trienoic acid) from 12R-hydroperoxyeicosatetraenoic acid (12R-HPETE). This epoxy alcohol can activate the the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha), which is implicated in epidermal differentiation. Loss of function of the enzyme encoded by this gene results in ichthyosis, implicating the function of this gene in the differentiation of human skin. This gene is part of a cluster of lipoxygenase genes on 17p13.1. Mutations in this gene result in nonbullous congenital ichthyosiform erythroderma (NCIE). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality, imapired skin barrier function, dehydration, tightly packed stratum corneum, impaired stratum corneum desquamation and reduced levels of ester-bound ceramide in the epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
5830411N06Rik	A	G	7: 140,296,321	S569G	possibly damaging	Het
Aars2	C	T	17: 45,520,295	P930S	probably benign	Het
Ada	T	A	2: 163,728,191	K301*	probably null	Het
Alb	T	C	5: 90,463,991	L93P	possibly damaging	Het
Aldh1l1	G	A	6: 90,570,862	G435S	probably benign	Het
Alox12b	A	T	11: 69,169,341	I627F	probably benign	Het
Arhgap29	C	T	3: 121,992,812	A342V	probably damaging	Het
BC024139	G	A	15: 76,120,568	P636L	possibly damaging	Het
Bmp6	G	T	13: 38,484,920	R293L	probably damaging	Het
Cfd	G	A	10: 79,891,613		probably null	Het
Csmd1	C	T	8: 15,917,273	A3197T	probably damaging	Het
Flii	G	A	11: 60,722,664	L166F	probably damaging	Het
Fmn1	T	A	2: 113,365,477	N507K	unknown	Het
Foxe1	C	A	4: 46,344,545	R118S	possibly damaging	Het
Fras1	T	C	5: 96,692,624	V1646A	probably benign	Het
Gm14496	A	G	2: 181,995,918	T262A	possibly damaging	Het
Gpbp1	A	T	13: 111,439,124	S282T	probably benign	Het
Gria4	A	T	9: 4,462,029	N641K	probably damaging	Het
Grin2a	T	G	16: 9,992,463	N24T	probably benign	Het
Gstm2	T	G	3: 107,985,676	D40A	probably benign	Het
H2afy	T	C	13: 56,128,333	Y39C	probably damaging	Het
Heatr1	T	A	13: 12,411,262	I657N	probably benign	Het
Kmt2b	T	C	7: 30,583,231	E1102G	possibly damaging	Het
Mgam	T	A	6: 40,659,010	N366K	probably benign	Het
Mier2	A	T	10: 79,549,676	V35E	probably damaging	Het
Mlxipl	T	C	5: 135,132,370	F381S	possibly damaging	Het
Mroh1	A	G	15: 76,451,848	H1474R	possibly damaging	Het
Mtrf1l	G	T	10: 5,815,620	A239E	probably damaging	Het
Nbea	G	T	3: 55,717,779	A2297E	probably damaging	Het
Nectin4	A	G	1: 171,380,259	E73G	probably benign	Het
Neurl1b	C	G	17: 26,438,746	H219Q	probably benign	Het
Nfia	G	A	4: 97,783,505	V151I	probably damaging	Het
Nol6	A	G	4: 41,118,717	L720P	probably damaging	Het
Olfr58	A	G	9: 19,783,543	N137D	possibly damaging	Het
Olfr772	A	G	10: 129,174,259	F254S	probably damaging	Het
Patj	A	G	4: 98,518,942	E1054G	probably damaging	Het
Pcnx	A	G	12: 81,990,551	D1861G	probably damaging	Het
Prss12	A	G	3: 123,447,396	T80A	probably benign	Het
Sgsm1	C	A	5: 113,253,024	R1000L	probably damaging	Het
Sulf2	T	C	2: 166,093,596	D199G	possibly damaging	Het
Suox	T	C	10: 128,670,911	D416G	probably benign	Het
Syne1	G	A	10: 5,061,531	T38M	probably damaging	Het
Tcf7l2	T	A	19: 55,924,543	C421*	probably null	Het
Traf7	C	A	17: 24,513,308	G143*	probably null	Het
Trappc12	T	C	12: 28,711,958	I544V	probably benign	Het
Trmt1	G	A	8: 84,697,551	V434I	probably benign	Het
Ttc5	T	C	14: 50,777,330	H160R	probably benign	Het
Xirp2	T	A	2: 67,512,177	H1587Q	probably benign	Het
Zfp523	C	T	17: 28,201,041	T220M	probably damaging	Het
Zfp804b	A	T	5: 6,769,362	S1234T	probably damaging	Het

Other mutations in Aloxe3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01621:Aloxe3	APN	11	69130013	missense	probably benign	0.41
IGL01925:Aloxe3	APN	11	69128633	missense	probably damaging	1.00
IGL01947:Aloxe3	APN	11	69143021	splice site	probably benign
IGL02421:Aloxe3	APN	11	69130046	missense	possibly damaging	0.87
IGL03206:Aloxe3	APN	11	69129646	missense	possibly damaging	0.74
IGL03054:Aloxe3	UTSW	11	69129607	missense	possibly damaging	0.78
R1613:Aloxe3	UTSW	11	69130046	missense	possibly damaging	0.87
R1757:Aloxe3	UTSW	11	69135949	missense	possibly damaging	0.72
R1839:Aloxe3	UTSW	11	69130085	missense	probably damaging	1.00
R2182:Aloxe3	UTSW	11	69129600	missense	possibly damaging	0.93
R2912:Aloxe3	UTSW	11	69130040	missense	probably damaging	1.00
R2919:Aloxe3	UTSW	11	69142923	missense	probably damaging	0.99
R2920:Aloxe3	UTSW	11	69142923	missense	probably damaging	0.99
R4731:Aloxe3	UTSW	11	69128654	missense	probably null	0.59
R5245:Aloxe3	UTSW	11	69129676	missense	probably benign	0.00
R5459:Aloxe3	UTSW	11	69132828	missense	possibly damaging	0.66
R5493:Aloxe3	UTSW	11	69128617	nonsense	probably null
R5725:Aloxe3	UTSW	11	69128654	missense	probably null	0.59
R5755:Aloxe3	UTSW	11	69132749	missense	probably benign	0.04
R5789:Aloxe3	UTSW	11	69126439	missense	probably damaging	1.00
R7343:Aloxe3	UTSW	11	69132743	missense	probably benign	0.00
R7419:Aloxe3	UTSW	11	69127527	missense	probably benign	0.00
R7451:Aloxe3	UTSW	11	69142920	missense	possibly damaging	0.90
R7964:Aloxe3	UTSW	11	69126536	missense	probably damaging	0.99
R8080:Aloxe3	UTSW	11	69133074	missense	probably damaging	1.00
R8492:Aloxe3	UTSW	11	69126475	missense	possibly damaging	0.61
R8694:Aloxe3	UTSW	11	69142851	missense	probably damaging	1.00
R8998:Aloxe3	UTSW	11	69142225	missense	probably benign	0.03
R9185:Aloxe3	UTSW	11	69134288	missense	probably damaging	0.99
R9222:Aloxe3	UTSW	11	69133077	missense	probably damaging	0.99
X0019:Aloxe3	UTSW	11	69148735	missense	probably damaging	1.00
X0020:Aloxe3	UTSW	11	69133027	critical splice acceptor site	probably null
Z1176:Aloxe3	UTSW	11	69133079	missense	probably damaging	1.00
Z1186:Aloxe3	UTSW	11	69128675	missense	probably benign
Z1186:Aloxe3	UTSW	11	69148603	missense	probably benign	0.00
Z1187:Aloxe3	UTSW	11	69128675	missense	probably benign
Z1187:Aloxe3	UTSW	11	69148603	missense	probably benign	0.00
Z1188:Aloxe3	UTSW	11	69128675	missense	probably benign
Z1188:Aloxe3	UTSW	11	69148603	missense	probably benign	0.00
Z1189:Aloxe3	UTSW	11	69128675	missense	probably benign
Z1189:Aloxe3	UTSW	11	69148603	missense	probably benign	0.00
Z1190:Aloxe3	UTSW	11	69128675	missense	probably benign
Z1190:Aloxe3	UTSW	11	69148603	missense	probably benign	0.00
Z1191:Aloxe3	UTSW	11	69128675	missense	probably benign
Z1191:Aloxe3	UTSW	11	69148603	missense	probably benign	0.00
Z1192:Aloxe3	UTSW	11	69128675	missense	probably benign
Z1192:Aloxe3	UTSW	11	69148603	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAGTTTCAGTTGGTCTCCAGGC -3'
(R):5'- TGTCTGCCAGTTCCTATTTGAG -3'

Sequencing Primer
(F):5'- CAGTTGGTCTCCAGGCACTATAG -3'
(R):5'- GTTTCTTAAACTGGATGGAGTCAAG -3'

Posted On

2019-11-12