Incidental Mutation 'R7669:Alox12b'
ID592057
Institutional Source Beutler Lab
Gene Symbol Alox12b
Ensembl Gene ENSMUSG00000032807
Gene Namearachidonate 12-lipoxygenase, 12R type
Synonymse-LOX2, 12R-LOX, Aloxe2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69156989-69169792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69169341 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 627 (I627F)
Ref Sequence ENSEMBL: ENSMUSP00000035250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036424]
Predicted Effect probably benign
Transcript: ENSMUST00000036424
AA Change: I627F

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035250
Gene: ENSMUSG00000032807
AA Change: I627F

DomainStartEndE-ValueType
LH2 2 116 9.9e-32 SMART
low complexity region 164 175 N/A INTRINSIC
Pfam:Lipoxygenase 228 686 5.3e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the conversion of arachidonic acid to 12R-hydroxyeicosatetraenoic acid. Mutations in this gene can prevent the formation of the epidermal permeability barrier and cause an ichthyosiform phenotype. [provided by RefSeq, Sep 2015]
PHENOTYPE: Neonatal homozygous mutant mice exhibit reddened skin that quickly dehydrates and appears scaly. The epidermis is hyperkeratotic, and its permeability barrier function is compromised. Homozygotes die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Alox12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Alox12b APN 11 69166243 missense probably damaging 1.00
IGL02990:Alox12b APN 11 69163206 missense probably benign 0.17
IGL03106:Alox12b APN 11 69168876 nonsense probably null
R0126:Alox12b UTSW 11 69167471 missense probably benign 0.36
R0135:Alox12b UTSW 11 69162748 missense probably benign 0.06
R0305:Alox12b UTSW 11 69167379 missense probably benign 0.25
R0432:Alox12b UTSW 11 69169556 missense probably damaging 1.00
R0828:Alox12b UTSW 11 69166306 missense possibly damaging 0.89
R0854:Alox12b UTSW 11 69164476 critical splice donor site probably null
R1139:Alox12b UTSW 11 69164405 missense probably damaging 1.00
R1558:Alox12b UTSW 11 69165885 missense probably damaging 1.00
R1870:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R4088:Alox12b UTSW 11 69158385 missense probably benign 0.14
R4195:Alox12b UTSW 11 69169600 missense probably benign 0.02
R4248:Alox12b UTSW 11 69163605 missense probably benign
R4371:Alox12b UTSW 11 69169616 missense possibly damaging 0.86
R4774:Alox12b UTSW 11 69163207 missense probably benign 0.00
R5108:Alox12b UTSW 11 69157382 missense probably benign 0.11
R5252:Alox12b UTSW 11 69165936 missense probably damaging 1.00
R5579:Alox12b UTSW 11 69162932 missense probably benign 0.04
R6000:Alox12b UTSW 11 69169568 missense probably damaging 0.98
R6168:Alox12b UTSW 11 69169634 missense probably damaging 1.00
R6322:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R6634:Alox12b UTSW 11 69168821 nonsense probably null
R7026:Alox12b UTSW 11 69157305 missense possibly damaging 0.66
R7519:Alox12b UTSW 11 69163213 missense probably benign 0.37
R7863:Alox12b UTSW 11 69166927 missense probably damaging 1.00
R7870:Alox12b UTSW 11 69169309 missense possibly damaging 0.76
R7946:Alox12b UTSW 11 69166927 missense probably damaging 1.00
R7953:Alox12b UTSW 11 69169309 missense possibly damaging 0.76
R7998:Alox12b UTSW 11 69168837 missense probably damaging 0.99
X0018:Alox12b UTSW 11 69157299 missense probably damaging 1.00
Z1176:Alox12b UTSW 11 69157323 missense possibly damaging 0.95
Z1176:Alox12b UTSW 11 69157325 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGACAGGGATCCAACTCAAC -3'
(R):5'- ATGCTGGGACAAAGCCAAGC -3'

Sequencing Primer
(F):5'- CTCAACCACCAGAGAGGGATG -3'
(R):5'- AGCCATCCACCCAATCCTTTCTG -3'
Posted On2019-11-12