Incidental Mutation 'R7669:Gpbp1'
ID592063
Institutional Source Beutler Lab
Gene Symbol Gpbp1
Ensembl Gene ENSMUSG00000032745
Gene NameGC-rich promoter binding protein 1
Synonyms1700034P14Rik, D230035M11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location111425680-111490111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111439124 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 282 (S282T)
Ref Sequence ENSEMBL: ENSMUSP00000048240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047627] [ENSMUST00000091236] [ENSMUST00000136471] [ENSMUST00000231096]
Predicted Effect probably benign
Transcript: ENSMUST00000047627
AA Change: S282T

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048240
Gene: ENSMUSG00000032745
AA Change: S282T

DomainStartEndE-ValueType
low complexity region 232 243 N/A INTRINSIC
Pfam:Vasculin 395 491 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091236
AA Change: S262T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088777
Gene: ENSMUSG00000032745
AA Change: S262T

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
Pfam:Vasculin 374 471 1.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136471
Predicted Effect probably benign
Transcript: ENSMUST00000231096
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally isolated by subtractive hybridization of cDNAs expressed in atherosclerotic plaques with a thrombus, and was found to be expressed only in vascular smooth muscle cells. However, a shorter splice variant was found to be more ubiquitously expressed. This protein is suggested to play a role in the development of atherosclerosis. Studies in mice suggest that it may also function as a GC-rich promoter-specific trans-activating transcription factor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Gpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gpbp1 APN 13 111440750 missense probably damaging 0.96
IGL01360:Gpbp1 APN 13 111426541 utr 3 prime probably benign
IGL01609:Gpbp1 APN 13 111439202 missense possibly damaging 0.62
IGL01747:Gpbp1 APN 13 111453050 missense probably damaging 0.99
IGL02614:Gpbp1 APN 13 111436473 missense probably benign 0.01
IGL03329:Gpbp1 APN 13 111453253 splice site probably benign
R0315:Gpbp1 UTSW 13 111436538 missense possibly damaging 0.50
R0510:Gpbp1 UTSW 13 111440745 missense possibly damaging 0.58
R1549:Gpbp1 UTSW 13 111436579 missense probably benign 0.00
R1582:Gpbp1 UTSW 13 111436532 unclassified probably null
R1762:Gpbp1 UTSW 13 111440774 missense probably benign 0.02
R2074:Gpbp1 UTSW 13 111453407 missense probably benign 0.18
R2276:Gpbp1 UTSW 13 111466978 splice site probably null
R3685:Gpbp1 UTSW 13 111466871 missense probably benign 0.06
R4307:Gpbp1 UTSW 13 111448983 makesense probably null
R4408:Gpbp1 UTSW 13 111448964 missense possibly damaging 0.63
R4840:Gpbp1 UTSW 13 111440630 critical splice donor site probably null
R4952:Gpbp1 UTSW 13 111440750 missense probably damaging 0.96
R5152:Gpbp1 UTSW 13 111453281 intron probably benign
R5376:Gpbp1 UTSW 13 111426642 missense probably damaging 1.00
R6143:Gpbp1 UTSW 13 111466855 missense probably damaging 0.98
R6378:Gpbp1 UTSW 13 111433612 missense probably damaging 1.00
R6516:Gpbp1 UTSW 13 111453102 missense probably benign 0.05
R6687:Gpbp1 UTSW 13 111438085 missense possibly damaging 0.78
R6745:Gpbp1 UTSW 13 111453385 missense probably benign 0.05
R7186:Gpbp1 UTSW 13 111440699 missense possibly damaging 0.89
R7310:Gpbp1 UTSW 13 111453390 missense probably benign 0.02
R7881:Gpbp1 UTSW 13 111439199 missense possibly damaging 0.45
R7964:Gpbp1 UTSW 13 111439199 missense possibly damaging 0.45
Predicted Primers PCR Primer
(F):5'- AACAGGTGTATCTAATAAGCTGGTA -3'
(R):5'- AATCATTGCTTAGTTGTTCCCCT -3'

Sequencing Primer
(F):5'- GCTGGTAAACTAACAGGATTTAGTAC -3'
(R):5'- GCTTAGTTGTTCCCCTTCACTTTG -3'
Posted On2019-11-12