Incidental Mutation 'R7669:Ttc5'
ID592064
Institutional Source Beutler Lab
Gene Symbol Ttc5
Ensembl Gene ENSMUSG00000006288
Gene Nametetratricopeptide repeat domain 5
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50765415-50785519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50777330 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 160 (H160R)
Ref Sequence ENSEMBL: ENSMUSP00000006451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006451] [ENSMUST00000226768] [ENSMUST00000228440]
PDB Structure
Crystal structure of full length mouse Strap (TTC5) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006451
AA Change: H160R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006451
Gene: ENSMUSG00000006288
AA Change: H160R

DomainStartEndE-ValueType
Pfam:TPR_2 103 136 1.6e-5 PFAM
Blast:TPR 224 257 2e-8 BLAST
low complexity region 261 280 N/A INTRINSIC
Pfam:TTC5_OB 318 432 3.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226768
AA Change: H160R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000228440
AA Change: H160R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Ttc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03398:Ttc5 APN 14 50781507 missense possibly damaging 0.73
R0665:Ttc5 UTSW 14 50765958 missense probably benign 0.17
R0667:Ttc5 UTSW 14 50765958 missense probably benign 0.17
R1125:Ttc5 UTSW 14 50777878 missense probably damaging 1.00
R1186:Ttc5 UTSW 14 50767226 nonsense probably null
R2011:Ttc5 UTSW 14 50781550 nonsense probably null
R2119:Ttc5 UTSW 14 50775365 missense probably damaging 1.00
R4394:Ttc5 UTSW 14 50781505 missense probably benign 0.01
R6050:Ttc5 UTSW 14 50773287 missense probably damaging 1.00
R6059:Ttc5 UTSW 14 50777846 missense probably damaging 0.97
R6329:Ttc5 UTSW 14 50765928 missense possibly damaging 0.94
R6451:Ttc5 UTSW 14 50767207 missense probably damaging 0.99
R6612:Ttc5 UTSW 14 50785469 unclassified probably null
R7311:Ttc5 UTSW 14 50765943 missense probably damaging 1.00
R7712:Ttc5 UTSW 14 50773312 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGATGGCCTCAAGTCAGAC -3'
(R):5'- GTTTGGCCTAGGTGAGAAGAAC -3'

Sequencing Primer
(F):5'- AGTCAGACAACACAGCTGG -3'
(R):5'- TTGGCCTAGGTGAGAAGAACATTTG -3'
Posted On2019-11-12