Incidental Mutation 'R7669:Neurl1b'
ID592070
Institutional Source Beutler Lab
Gene Symbol Neurl1b
Ensembl Gene ENSMUSG00000034413
Gene Nameneuralized E3 ubiquitin protein ligase 1B
SynonymsC230078M08Rik, Neur2, EG240055
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location26414829-26446349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 26438746 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 219 (H219Q)
Ref Sequence ENSEMBL: ENSMUSP00000051481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053020] [ENSMUST00000182897] [ENSMUST00000183077]
Predicted Effect probably benign
Transcript: ENSMUST00000053020
AA Change: H219Q

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051481
Gene: ENSMUSG00000034413
AA Change: H219Q

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 192 1e-12 BLAST
Blast:NEUZ 219 245 1e-8 BLAST
NEUZ 268 390 7.66e-24 SMART
low complexity region 436 449 N/A INTRINSIC
low complexity region 457 486 N/A INTRINSIC
RING 494 533 2.38e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182897
AA Change: H37Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138417
Gene: ENSMUSG00000034413
AA Change: H37Q

DomainStartEndE-ValueType
Blast:NEUZ 37 63 5e-9 BLAST
Pfam:Neuralized 88 156 2.8e-14 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 304 N/A INTRINSIC
RING 312 351 2.38e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183077
SMART Domains Protein: ENSMUSP00000138178
Gene: ENSMUSG00000034413

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 225 2e-14 BLAST
low complexity region 226 255 N/A INTRINSIC
RING 263 302 2.38e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Neurl1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Neurl1b APN 17 26432178 missense probably damaging 0.99
R0530:Neurl1b UTSW 17 26441545 splice site probably null
R1819:Neurl1b UTSW 17 26438700 missense probably benign 0.01
R2359:Neurl1b UTSW 17 26441595 missense probably benign 0.03
R3720:Neurl1b UTSW 17 26414975 missense probably damaging 1.00
R4574:Neurl1b UTSW 17 26431886 missense probably benign 0.19
R7508:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7509:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7642:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7654:Neurl1b UTSW 17 26438697 missense probably benign 0.00
R7670:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7722:Neurl1b UTSW 17 26441158 missense probably benign
R8069:Neurl1b UTSW 17 26432227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGAGGTTGCAGGTCAGG -3'
(R):5'- CAGTATTCCTTGCGGTCCAG -3'

Sequencing Primer
(F):5'- TTGCAGGTCAGGGGCAACTG -3'
(R):5'- ATCGCAGGACGTGATGC -3'
Posted On2019-11-12