Incidental Mutation 'R7669:Zfp523'
ID592071
Institutional Source Beutler Lab
Gene Symbol Zfp523
Ensembl Gene ENSMUSG00000024220
Gene Namezinc finger protein 523
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R7669 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28177207-28205886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28201041 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 220 (T220M)
Ref Sequence ENSEMBL: ENSMUSP00000002318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002318] [ENSMUST00000073534] [ENSMUST00000133868] [ENSMUST00000155030]
Predicted Effect probably damaging
Transcript: ENSMUST00000002318
AA Change: T220M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002318
Gene: ENSMUSG00000024220
AA Change: T220M

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073534
AA Change: T220M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073226
Gene: ENSMUSG00000024220
AA Change: T220M

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129522
Predicted Effect probably damaging
Transcript: ENSMUST00000133868
AA Change: T139M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123127
Gene: ENSMUSG00000024220
AA Change: T139M

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
ZnF_C2H2 84 108 7.15e-2 SMART
ZnF_C2H2 114 138 3.16e-3 SMART
ZnF_C2H2 144 168 8.47e-4 SMART
ZnF_C2H2 174 198 3.44e-4 SMART
ZnF_C2H2 204 228 1.69e-3 SMART
ZnF_C2H2 234 257 5.06e-2 SMART
low complexity region 264 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155030
SMART Domains Protein: ENSMUSP00000117730
Gene: ENSMUSG00000024220

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Tcf7l2 T A 19: 55,924,543 C421* probably null Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Zfp523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Zfp523 APN 17 28201049 missense possibly damaging 0.95
IGL01405:Zfp523 APN 17 28204506 missense probably damaging 0.99
IGL02430:Zfp523 APN 17 28195139 unclassified probably benign
R0496:Zfp523 UTSW 17 28200445 missense possibly damaging 0.83
R1533:Zfp523 UTSW 17 28204499 missense probably benign 0.18
R1837:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R1838:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R1839:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R2023:Zfp523 UTSW 17 28201004 unclassified probably benign
R2104:Zfp523 UTSW 17 28195216 missense probably benign 0.31
R2403:Zfp523 UTSW 17 28195209 missense probably damaging 1.00
R2864:Zfp523 UTSW 17 28202540 missense probably benign 0.00
R4157:Zfp523 UTSW 17 28202283 missense probably benign 0.06
R4214:Zfp523 UTSW 17 28201029 missense probably benign 0.04
R4771:Zfp523 UTSW 17 28201338 splice site probably null
R5869:Zfp523 UTSW 17 28194993 missense probably benign 0.37
R5950:Zfp523 UTSW 17 28202558 missense probably benign 0.06
R6443:Zfp523 UTSW 17 28201407 missense probably damaging 0.99
R6679:Zfp523 UTSW 17 28202220 missense probably damaging 1.00
R6694:Zfp523 UTSW 17 28200472 missense probably damaging 1.00
R8103:Zfp523 UTSW 17 28201293 missense probably damaging 1.00
R8315:Zfp523 UTSW 17 28202588 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTGGCCTTACAAAGCGTCC -3'
(R):5'- CACATGTACCTTGCGGATATTTG -3'

Sequencing Primer
(F):5'- TTACAAAGCGTCCCAGGGC -3'
(R):5'- AATGGGCGCTCACCTGTG -3'
Posted On2019-11-12