Incidental Mutation 'R7669:Tcf7l2'
ID592073
Institutional Source Beutler Lab
Gene Symbol Tcf7l2
Ensembl Gene ENSMUSG00000024985
Gene Nametranscription factor 7 like 2, T cell specific, HMG box
SynonymsTCF4B, mTcf-4B, mTcf-4E, TCF4E, Tcf4, Tcf-4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7669 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location55741810-55933654 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 55924543 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 421 (C421*)
Ref Sequence ENSEMBL: ENSMUSP00000107283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041717] [ENSMUST00000061496] [ENSMUST00000111646] [ENSMUST00000111653] [ENSMUST00000111654] [ENSMUST00000111656] [ENSMUST00000111657] [ENSMUST00000111658] [ENSMUST00000111659] [ENSMUST00000111662] [ENSMUST00000148666] [ENSMUST00000153888]
Predicted Effect probably benign
Transcript: ENSMUST00000041717
SMART Domains Protein: ENSMUSP00000042950
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000061496
AA Change: C421*
SMART Domains Protein: ENSMUSP00000050081
Gene: ENSMUSG00000024985
AA Change: C421*

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111646
AA Change: C261*
SMART Domains Protein: ENSMUSP00000107273
Gene: ENSMUSG00000024985
AA Change: C261*

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 76 2.4e-37 PFAM
HMG 166 236 1.16e-22 SMART
low complexity region 242 250 N/A INTRINSIC
c-clamp 278 298 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111653
SMART Domains Protein: ENSMUSP00000107280
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111654
SMART Domains Protein: ENSMUSP00000107281
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.2e-93 PFAM
HMG 345 415 1.16e-22 SMART
low complexity region 421 429 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111656
AA Change: C421*
SMART Domains Protein: ENSMUSP00000107283
Gene: ENSMUSG00000024985
AA Change: C421*

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 458 2.25e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111657
AA Change: C421*
SMART Domains Protein: ENSMUSP00000107284
Gene: ENSMUSG00000024985
AA Change: C421*

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 468 2.08e-14 SMART
low complexity region 471 498 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111658
SMART Domains Protein: ENSMUSP00000107286
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.5e-93 PFAM
HMG 350 420 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111659
SMART Domains Protein: ENSMUSP00000107287
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-96 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111662
SMART Domains Protein: ENSMUSP00000107291
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-103 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 421 442 1.23e-2 SMART
c-clamp 446 476 1.35e-13 SMART
low complexity region 479 506 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127233
SMART Domains Protein: ENSMUSP00000123428
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 229 9.3e-98 PFAM
HMG 319 389 1.16e-22 SMART
low complexity region 395 403 N/A INTRINSIC
c-clamp 414 434 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148666
SMART Domains Protein: ENSMUSP00000119759
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 10 106 5.7e-39 PFAM
HMG 196 265 1.02e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153888
SMART Domains Protein: ENSMUSP00000118661
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 217 1.2e-64 PFAM
HMG 307 377 1.16e-22 SMART
low complexity region 383 391 N/A INTRINSIC
c-clamp 402 432 5.29e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit intestinal epithelia abnormalities and die shortly after birth. Mice heterozygous for some mutations display abnormalities in glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5830411N06Rik A G 7: 140,296,321 S569G possibly damaging Het
Aars2 C T 17: 45,520,295 P930S probably benign Het
Ada T A 2: 163,728,191 K301* probably null Het
Alb T C 5: 90,463,991 L93P possibly damaging Het
Aldh1l1 G A 6: 90,570,862 G435S probably benign Het
Alox12b A T 11: 69,169,341 I627F probably benign Het
Aloxe3 A G 11: 69,135,120 I503V probably benign Het
Arhgap29 C T 3: 121,992,812 A342V probably damaging Het
BC024139 G A 15: 76,120,568 P636L possibly damaging Het
Bmp6 G T 13: 38,484,920 R293L probably damaging Het
Cfd G A 10: 79,891,613 probably null Het
Csmd1 C T 8: 15,917,273 A3197T probably damaging Het
Flii G A 11: 60,722,664 L166F probably damaging Het
Fmn1 T A 2: 113,365,477 N507K unknown Het
Foxe1 C A 4: 46,344,545 R118S possibly damaging Het
Fras1 T C 5: 96,692,624 V1646A probably benign Het
Gm14496 A G 2: 181,995,918 T262A possibly damaging Het
Gpbp1 A T 13: 111,439,124 S282T probably benign Het
Gria4 A T 9: 4,462,029 N641K probably damaging Het
Grin2a T G 16: 9,992,463 N24T probably benign Het
Gstm2 T G 3: 107,985,676 D40A probably benign Het
H2afy T C 13: 56,128,333 Y39C probably damaging Het
Heatr1 T A 13: 12,411,262 I657N probably benign Het
Kmt2b T C 7: 30,583,231 E1102G possibly damaging Het
Mgam T A 6: 40,659,010 N366K probably benign Het
Mier2 A T 10: 79,549,676 V35E probably damaging Het
Mlxipl T C 5: 135,132,370 F381S possibly damaging Het
Mroh1 A G 15: 76,451,848 H1474R possibly damaging Het
Mtrf1l G T 10: 5,815,620 A239E probably damaging Het
Nbea G T 3: 55,717,779 A2297E probably damaging Het
Nectin4 A G 1: 171,380,259 E73G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nfia G A 4: 97,783,505 V151I probably damaging Het
Nol6 A G 4: 41,118,717 L720P probably damaging Het
Olfr58 A G 9: 19,783,543 N137D possibly damaging Het
Olfr772 A G 10: 129,174,259 F254S probably damaging Het
Patj A G 4: 98,518,942 E1054G probably damaging Het
Pcnx A G 12: 81,990,551 D1861G probably damaging Het
Prss12 A G 3: 123,447,396 T80A probably benign Het
Sgsm1 C A 5: 113,253,024 R1000L probably damaging Het
Sulf2 T C 2: 166,093,596 D199G possibly damaging Het
Suox T C 10: 128,670,911 D416G probably benign Het
Syne1 G A 10: 5,061,531 T38M probably damaging Het
Traf7 C A 17: 24,513,308 G143* probably null Het
Trappc12 T C 12: 28,711,958 I544V probably benign Het
Trmt1 G A 8: 84,697,551 V434I probably benign Het
Ttc5 T C 14: 50,777,330 H160R probably benign Het
Xirp2 T A 2: 67,512,177 H1587Q probably benign Het
Zfp523 C T 17: 28,201,041 T220M probably damaging Het
Zfp804b A T 5: 6,769,362 S1234T probably damaging Het
Other mutations in Tcf7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Tcf7l2 APN 19 55917421 missense probably damaging 1.00
IGL01013:Tcf7l2 APN 19 55919627 splice site probably benign
IGL02871:Tcf7l2 APN 19 55918997 missense probably damaging 1.00
banned UTSW 19 55931432 critical splice acceptor site probably null
Notable UTSW 19 55926740 missense unknown
PIT4468001:Tcf7l2 UTSW 19 55742388 missense probably damaging 1.00
R0927:Tcf7l2 UTSW 19 55918955 missense probably damaging 1.00
R1078:Tcf7l2 UTSW 19 55743195 missense probably benign 0.19
R4580:Tcf7l2 UTSW 19 55919036 missense probably damaging 1.00
R4721:Tcf7l2 UTSW 19 55931454 missense possibly damaging 0.89
R4814:Tcf7l2 UTSW 19 55924072 nonsense probably null
R4957:Tcf7l2 UTSW 19 55931432 critical splice acceptor site probably null
R5222:Tcf7l2 UTSW 19 55898612 missense probably benign
R5484:Tcf7l2 UTSW 19 55919508 splice site probably null
R5808:Tcf7l2 UTSW 19 55908541 missense probably damaging 1.00
R5914:Tcf7l2 UTSW 19 55898560 missense probably benign 0.00
R6077:Tcf7l2 UTSW 19 55917436 nonsense probably null
R6116:Tcf7l2 UTSW 19 55919014 missense probably damaging 1.00
R6861:Tcf7l2 UTSW 19 55742523 missense probably damaging 1.00
R6970:Tcf7l2 UTSW 19 55755048 missense probably benign 0.44
R7009:Tcf7l2 UTSW 19 55894733 critical splice donor site probably null
R7382:Tcf7l2 UTSW 19 55926740 missense unknown
R7761:Tcf7l2 UTSW 19 55926036 missense probably damaging 1.00
R7823:Tcf7l2 UTSW 19 55743089 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CTGGGCTGATCCTGAATGTTTC -3'
(R):5'- AACGCAACCATGTAGATGATCG -3'

Sequencing Primer
(F):5'- CAATGCATGCCTTTACAGTGG -3'
(R):5'- TTAACGACTCAAAAGCACATTA -3'
Posted On2019-11-12