Incidental Mutation 'R7670:Slc9a2'
ID592074
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms2210416H12Rik, 4932415O19Rik, NHE2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7670 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40680574-40769273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40718997 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 232 (V232D)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
Predicted Effect probably damaging
Transcript: ENSMUST00000027231
AA Change: V232D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: V232D

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192345
AA Change: V232D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: V232D

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Adam26a T A 8: 43,570,153 H100L probably benign Het
Adgrf2 T C 17: 42,711,372 N187S probably damaging Het
Adipoq T A 16: 23,157,582 H244Q probably damaging Het
Arhgap40 T A 2: 158,531,925 S209T probably benign Het
Arrdc3 C T 13: 80,889,093 L123F probably damaging Het
Aspscr1 A G 11: 120,689,039 N212D probably benign Het
Ccr9 A T 9: 123,779,306 S18C probably damaging Het
Cdc42bpa T A 1: 180,065,081 V270D probably damaging Het
Clic4 A G 4: 135,217,205 Y220H probably damaging Het
Cntln A C 4: 84,979,340 H388P possibly damaging Het
Col12a1 A G 9: 79,631,643 V2457A probably damaging Het
Ctsk A G 3: 95,501,614 N103D probably benign Het
Ddx60 T C 8: 61,975,792 S779P probably damaging Het
Dnah5 T A 15: 28,246,232 probably null Het
Dnah7b T A 1: 46,109,302 D279E probably benign Het
Fam117a A G 11: 95,378,834 N308S probably benign Het
Fasn A G 11: 120,813,419 V1419A probably damaging Het
Fhad1 A G 4: 141,951,491 S625P probably benign Het
Gemin5 A G 11: 58,147,928 V585A probably benign Het
Gm5145 C A 17: 20,570,384 P8Q probably benign Het
Gm8332 T C 12: 88,249,754 N116S probably benign Het
Herc1 C A 9: 66,416,347 T1381K probably damaging Het
Herc6 T C 6: 57,660,122 I824T probably damaging Het
Klrb1 C T 6: 128,710,087 V161I probably benign Het
Krtap31-1 A G 11: 99,908,432 N154D not run Het
Lcp1 A T 14: 75,200,431 I94F probably benign Het
Lin7a A T 10: 107,382,691 Q154L possibly damaging Het
Lnx1 T C 5: 74,685,690 Y33C probably damaging Het
Myo5b T C 18: 74,701,446 V859A probably benign Het
Ncbp1 A G 4: 46,170,015 Q696R probably damaging Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nme8 T C 13: 19,658,829 E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,111,974 probably null Het
Nuggc A G 14: 65,613,526 I298V probably damaging Het
Nup155 A C 15: 8,153,696 K1247Q probably damaging Het
Olfr368 A T 2: 37,331,759 E4V probably benign Het
Olfr403 A G 11: 74,196,207 K235E probably damaging Het
Otud4 T A 8: 79,655,864 probably null Het
Pcdhb18 T C 18: 37,491,696 V693A probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Prkca A T 11: 108,014,344 N189K probably damaging Het
Rbm24 A G 13: 46,429,207 I201V probably benign Het
Reep6 T C 10: 80,333,793 L105P probably damaging Het
Retreg1 T C 15: 25,941,040 probably benign Het
Rev3l C T 10: 39,836,722 T2382I probably benign Het
Rnf31 A G 14: 55,594,361 N230S probably benign Het
Rreb1 T C 13: 37,931,572 L969P probably benign Het
Rsph4a T A 10: 33,909,033 N313K probably damaging Het
Serpina3f T A 12: 104,217,266 L129Q probably damaging Het
Stmn2 T C 3: 8,554,865 L121P probably damaging Het
Svep1 C T 4: 58,097,424 G1373D probably damaging Het
Tmem206 A G 1: 191,340,868 N162S probably benign Het
Tns1 C A 1: 73,952,477 R1014L possibly damaging Het
Top2b T C 14: 16,416,620 S1127P possibly damaging Het
Txndc16 A T 14: 45,135,867 C768* probably null Het
Ubl7 A T 9: 57,929,769 E354D probably benign Het
Ush2a T C 1: 188,784,708 L3205P possibly damaging Het
Xirp2 A G 2: 67,510,573 T1053A possibly damaging Het
Zbtb21 A G 16: 97,951,877 L402P probably damaging Het
Zfp27 T A 7: 29,894,796 K581N possibly damaging Het
Zfp62 A T 11: 49,215,076 probably benign Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
R7970:Slc9a2 UTSW 1 40726214 missense probably damaging 0.98
R8104:Slc9a2 UTSW 1 40718649 missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40767711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGTGGTAGGCACACTG -3'
(R):5'- TACATGCACATATAAGCTCTGTGAG -3'

Sequencing Primer
(F):5'- TAGGCACACTGTGGAATTCC -3'
(R):5'- AGAAGGTGTGAGAACTCTGATG -3'
Posted On2019-11-12