Mutagenetix > Incidental Mutation

Incidental Mutation 'R7670:Tns1'

592076

Institutional Source

Beutler Lab

Gene Symbol

Tns1

Ensembl Gene

ENSMUSG00000055322

Gene Name

tensin 1

Synonyms

1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R7670 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73910231-74124449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 73952477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1014 (R1014L)

Ref Sequence

ENSEMBL: ENSMUSP00000127715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000191104] [ENSMUST00000191367] [ENSMUST00000212888]

AlphaFold

E9Q0S6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169786
AA Change: R1014L

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: R1014L

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	1.77e-2	SMART
low complexity region	154	167	N/A	INTRINSIC
SCOP:d1d5ra2	176	348	3e-32	SMART
PTEN_C2	350	477	1.12e-51	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1227	1239	N/A	INTRINSIC
low complexity region	1284	1300	N/A	INTRINSIC
low complexity region	1459	1470	N/A	INTRINSIC
low complexity region	1518	1530	N/A	INTRINSIC
SH2	1614	1716	6.85e-17	SMART
PTB	1747	1888	1.69e-29	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000187584
AA Change: R970L

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: R970L

Domain	Start	End	E-Value	Type
C1	21	67	8.6e-5	SMART
low complexity region	113	124	N/A	INTRINSIC
PTPc_DSPc	197	319	9.9e-6	SMART
PTEN_C2	306	433	5.6e-56	SMART
low complexity region	778	789	N/A	INTRINSIC
low complexity region	861	878	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1219	1235	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1453	1465	N/A	INTRINSIC
SH2	1549	1651	4.3e-19	SMART
PTB	1682	1823	9e-32	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191104
AA Change: R1014L

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: R1014L

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	8.6e-5	SMART
low complexity region	154	167	N/A	INTRINSIC
PTPc_DSPc	241	363	9.9e-6	SMART
PTEN_C2	350	477	5.6e-56	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1206	1218	N/A	INTRINSIC
low complexity region	1263	1279	N/A	INTRINSIC
low complexity region	1438	1449	N/A	INTRINSIC
low complexity region	1497	1509	N/A	INTRINSIC
SH2	1593	1695	4.3e-19	SMART
PTB	1726	1867	9e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191367

Predicted Effect

probably damaging
Transcript: ENSMUST00000212888
AA Change: R1014L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
Adam26a	T	A	8: 43,570,153	H100L	probably benign	Het
Adgrf2	T	C	17: 42,711,372	N187S	probably damaging	Het
Adipoq	T	A	16: 23,157,582	H244Q	probably damaging	Het
Arhgap40	T	A	2: 158,531,925	S209T	probably benign	Het
Arrdc3	C	T	13: 80,889,093	L123F	probably damaging	Het
Aspscr1	A	G	11: 120,689,039	N212D	probably benign	Het
Ccr9	A	T	9: 123,779,306	S18C	probably damaging	Het
Cdc42bpa	T	A	1: 180,065,081	V270D	probably damaging	Het
Clic4	A	G	4: 135,217,205	Y220H	probably damaging	Het
Cntln	A	C	4: 84,979,340	H388P	possibly damaging	Het
Col12a1	A	G	9: 79,631,643	V2457A	probably damaging	Het
Ctsk	A	G	3: 95,501,614	N103D	probably benign	Het
Ddx60	T	C	8: 61,975,792	S779P	probably damaging	Het
Dnah5	T	A	15: 28,246,232		probably null	Het
Dnah7b	T	A	1: 46,109,302	D279E	probably benign	Het
Fam117a	A	G	11: 95,378,834	N308S	probably benign	Het
Fasn	A	G	11: 120,813,419	V1419A	probably damaging	Het
Fhad1	A	G	4: 141,951,491	S625P	probably benign	Het
Gemin5	A	G	11: 58,147,928	V585A	probably benign	Het
Gm5145	C	A	17: 20,570,384	P8Q	probably benign	Het
Gm8332	T	C	12: 88,249,754	N116S	probably benign	Het
Herc1	C	A	9: 66,416,347	T1381K	probably damaging	Het
Herc6	T	C	6: 57,660,122	I824T	probably damaging	Het
Klrb1	C	T	6: 128,710,087	V161I	probably benign	Het
Krtap31-1	A	G	11: 99,908,432	N154D	not run	Het
Lcp1	A	T	14: 75,200,431	I94F	probably benign	Het
Lin7a	A	T	10: 107,382,691	Q154L	possibly damaging	Het
Lnx1	T	C	5: 74,685,690	Y33C	probably damaging	Het
Myo5b	T	C	18: 74,701,446	V859A	probably benign	Het
Ncbp1	A	G	4: 46,170,015	Q696R	probably damaging	Het
Neurl1b	C	G	17: 26,438,746	H219Q	probably benign	Het
Nme8	T	C	13: 19,658,829	E392G	probably benign	Het
Nufip1	CAAAACAGAAAACAGAAAAC	CAAAACAGAAAACAGAAAACAGAAAAC	14: 76,111,974		probably null	Het
Nuggc	A	G	14: 65,613,526	I298V	probably damaging	Het
Nup155	A	C	15: 8,153,696	K1247Q	probably damaging	Het
Olfr368	A	T	2: 37,331,759	E4V	probably benign	Het
Olfr403	A	G	11: 74,196,207	K235E	probably damaging	Het
Otud4	T	A	8: 79,655,864		probably null	Het
Pcdhb18	T	C	18: 37,491,696	V693A	probably damaging	Het
Pcnx3	A	G	19: 5,677,182	F1108L	probably benign	Het
Prkca	A	T	11: 108,014,344	N189K	probably damaging	Het
Rbm24	A	G	13: 46,429,207	I201V	probably benign	Het
Reep6	T	C	10: 80,333,793	L105P	probably damaging	Het
Retreg1	T	C	15: 25,941,040		probably benign	Het
Rev3l	C	T	10: 39,836,722	T2382I	probably benign	Het
Rnf31	A	G	14: 55,594,361	N230S	probably benign	Het
Rreb1	T	C	13: 37,931,572	L969P	probably benign	Het
Rsph4a	T	A	10: 33,909,033	N313K	probably damaging	Het
Serpina3f	T	A	12: 104,217,266	L129Q	probably damaging	Het
Slc9a2	T	A	1: 40,718,997	V232D	probably damaging	Het
Stmn2	T	C	3: 8,554,865	L121P	probably damaging	Het
Svep1	C	T	4: 58,097,424	G1373D	probably damaging	Het
Tmem206	A	G	1: 191,340,868	N162S	probably benign	Het
Top2b	T	C	14: 16,416,620	S1127P	possibly damaging	Het
Txndc16	A	T	14: 45,135,867	C768*	probably null	Het
Ubl7	A	T	9: 57,929,769	E354D	probably benign	Het
Ush2a	T	C	1: 188,784,708	L3205P	possibly damaging	Het
Xirp2	A	G	2: 67,510,573	T1053A	possibly damaging	Het
Zbtb21	A	G	16: 97,951,877	L402P	probably damaging	Het
Zfp27	T	A	7: 29,894,796	K581N	possibly damaging	Het
Zfp62	A	T	11: 49,215,076		probably benign	Het

Other mutations in Tns1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Tns1	APN	1	73924969	missense	probably damaging	0.99
IGL01288:Tns1	APN	1	73953810	missense	probably damaging	1.00
IGL01536:Tns1	APN	1	73919648	splice site	probably benign
IGL01568:Tns1	APN	1	73953509	missense	probably damaging	1.00
IGL01683:Tns1	APN	1	73953269	missense	probably damaging	0.98
IGL02267:Tns1	APN	1	73992131	missense	possibly damaging	0.95
IGL02597:Tns1	APN	1	73985873	critical splice donor site	probably null
IGL02819:Tns1	APN	1	73937248	missense	probably damaging	0.99
IGL03370:Tns1	APN	1	73985894	missense	probably damaging	1.00
R0087:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R0207:Tns1	UTSW	1	73937318	critical splice acceptor site	probably null
R0411:Tns1	UTSW	1	73925761	missense	probably damaging	0.96
R0543:Tns1	UTSW	1	73952697	missense	probably benign	0.01
R0552:Tns1	UTSW	1	73920563	missense	probably damaging	1.00
R0720:Tns1	UTSW	1	73925581	missense	probably benign	0.03
R0828:Tns1	UTSW	1	73919666	missense	probably damaging	1.00
R1034:Tns1	UTSW	1	73941969	missense	probably damaging	1.00
R1061:Tns1	UTSW	1	73917672	missense	probably damaging	1.00
R1819:Tns1	UTSW	1	73916476	splice site	probably benign
R1826:Tns1	UTSW	1	73953634	start codon destroyed	probably null	0.91
R2208:Tns1	UTSW	1	74079240	missense	probably damaging	1.00
R3723:Tns1	UTSW	1	73924940	missense	probably damaging	0.99
R4079:Tns1	UTSW	1	73995308	missense	probably damaging	1.00
R4111:Tns1	UTSW	1	73941932	missense	probably damaging	1.00
R4155:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4156:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4157:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4274:Tns1	UTSW	1	73928098	missense	probably damaging	1.00
R4426:Tns1	UTSW	1	73985749	missense	probably damaging	0.97
R4649:Tns1	UTSW	1	73953771	missense	probably damaging	1.00
R4742:Tns1	UTSW	1	74124290	critical splice donor site	probably null
R4869:Tns1	UTSW	1	73952615	missense	probably benign
R4961:Tns1	UTSW	1	73935915	missense	probably benign	0.35
R5025:Tns1	UTSW	1	73925482	missense	probably damaging	1.00
R5035:Tns1	UTSW	1	73953820	start gained	probably benign
R5062:Tns1	UTSW	1	73952864	missense	probably damaging	1.00
R5080:Tns1	UTSW	1	73952940	missense	probably damaging	1.00
R5213:Tns1	UTSW	1	73953612	missense	probably damaging	1.00
R5256:Tns1	UTSW	1	73995426	intron	probably benign
R5368:Tns1	UTSW	1	73941017	missense	probably benign	0.07
R5391:Tns1	UTSW	1	73990409	splice site	probably null
R5587:Tns1	UTSW	1	73920596	missense	possibly damaging	0.94
R5735:Tns1	UTSW	1	73927979	missense	probably benign	0.00
R5855:Tns1	UTSW	1	73918033	missense	possibly damaging	0.83
R5999:Tns1	UTSW	1	73928097	nonsense	probably null
R6122:Tns1	UTSW	1	73952419	critical splice donor site	probably null
R6148:Tns1	UTSW	1	73953453	missense	probably damaging	1.00
R6457:Tns1	UTSW	1	73918050	missense	probably damaging	0.99
R6525:Tns1	UTSW	1	73953470	missense	probably damaging	1.00
R6712:Tns1	UTSW	1	74079301	nonsense	probably null
R6773:Tns1	UTSW	1	73919707	missense	probably damaging	1.00
R6825:Tns1	UTSW	1	74002323	nonsense	probably null
R7085:Tns1	UTSW	1	73925462	missense	probably benign	0.00
R7128:Tns1	UTSW	1	73995304	missense
R7209:Tns1	UTSW	1	73953915	missense	possibly damaging	0.68
R7348:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R7570:Tns1	UTSW	1	73953479	missense	probably damaging	1.00
R7769:Tns1	UTSW	1	73953371	missense	probably damaging	0.99
R7833:Tns1	UTSW	1	74091331	intron	probably benign
R8052:Tns1	UTSW	1	73953437	missense	probably damaging	1.00
R8225:Tns1	UTSW	1	73985887	missense	probably damaging	1.00
R8244:Tns1	UTSW	1	73937251	missense	probably damaging	1.00
R8321:Tns1	UTSW	1	73985780	critical splice acceptor site	probably null
R8344:Tns1	UTSW	1	73985042	missense	probably damaging	1.00
R8378:Tns1	UTSW	1	73937246	missense	probably damaging	1.00
R8434:Tns1	UTSW	1	73925606	missense	probably benign	0.00
R8773:Tns1	UTSW	1	73937248	missense	probably damaging	0.99
R9211:Tns1	UTSW	1	73917789	missense	possibly damaging	0.63
R9251:Tns1	UTSW	1	73991696	missense	probably damaging	1.00
R9315:Tns1	UTSW	1	73940982	missense
R9411:Tns1	UTSW	1	73953503	missense	probably damaging	1.00
R9592:Tns1	UTSW	1	73990394	missense	probably damaging	1.00
R9658:Tns1	UTSW	1	73942023	missense	probably benign	0.14
R9658:Tns1	UTSW	1	73942024	missense	probably benign	0.08
Z1177:Tns1	UTSW	1	74002307	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- CTCCTCAGGCTGAAACTGTGTTG -3'
(R):5'- TCTGGCAGGCCTTATTCACC -3'

Sequencing Primer
(F):5'- AACTGTGTTGTCAAAGGCCC -3'
(R):5'- TACGATTATCAGCTGCATCCAG -3'

Posted On

2019-11-12