Mutagenetix > Incidental Mutation

Incidental Mutation 'R7670:Cdc42bpa'

592077

Institutional Source

Beutler Lab

Gene Symbol

Cdc42bpa

Ensembl Gene

ENSMUSG00000026490

Gene Name

CDC42 binding protein kinase alpha

Synonyms

A930014J19Rik, DMPK-like

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.816) question?

Stock #

R7670 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

179960472-180165603 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 180065081 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 270 (V270D)

Ref Sequence

ENSEMBL: ENSMUSP00000106746 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000134959] [ENSMUST00000212756]

AlphaFold

Q3UU96

Predicted Effect

probably damaging
Transcript: ENSMUST00000076687
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: V270D

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	588	N/A	INTRINSIC
coiled coil region	632	735	N/A	INTRINSIC
Pfam:DMPK_coil	800	860	2.7e-29	PFAM
C1	919	968	4.09e-7	SMART
PH	989	1109	6.02e-8	SMART
CNH	1134	1411	3.37e-17	SMART
low complexity region	1456	1468	N/A	INTRINSIC
PBD	1477	1512	2.05e-10	SMART
low complexity region	1531	1546	N/A	INTRINSIC
low complexity region	1567	1580	N/A	INTRINSIC
low complexity region	1606	1620	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097450
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: V270D

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	669	N/A	INTRINSIC
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.2e-29	PFAM
C1	1000	1049	4.09e-7	SMART
PH	1070	1190	6.02e-8	SMART
CNH	1215	1492	3.37e-17	SMART
low complexity region	1537	1549	N/A	INTRINSIC
PBD	1558	1593	2.05e-10	SMART
low complexity region	1612	1627	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
low complexity region	1687	1701	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097453
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: V270D

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	669	N/A	INTRINSIC
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.5e-29	PFAM
C1	972	1021	4.09e-7	SMART
PH	1042	1162	6.02e-8	SMART
CNH	1187	1464	3.37e-17	SMART
low complexity region	1509	1521	N/A	INTRINSIC
PBD	1530	1565	2.05e-10	SMART
low complexity region	1584	1599	N/A	INTRINSIC
low complexity region	1620	1633	N/A	INTRINSIC
low complexity region	1659	1673	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111117
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: V270D

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
low complexity region	484	499	N/A	INTRINSIC
Pfam:KELK	529	608	1.1e-32	PFAM
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.6e-29	PFAM
C1	1013	1062	4.09e-7	SMART
PH	1083	1203	6.02e-8	SMART
CNH	1228	1505	3.37e-17	SMART
low complexity region	1550	1562	N/A	INTRINSIC
PBD	1571	1606	2.05e-10	SMART
low complexity region	1625	1640	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
low complexity region	1700	1714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134959

SMART Domains

Protein: ENSMUSP00000142018
Gene: ENSMUSG00000026490

Domain	Start	End	E-Value	Type
PDB:4AW2\|A	2	90	1e-58	PDB
SCOP:d1koba_	50	90	7e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212756
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9561

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
Adam26a	T	A	8: 43,570,153	H100L	probably benign	Het
Adgrf2	T	C	17: 42,711,372	N187S	probably damaging	Het
Adipoq	T	A	16: 23,157,582	H244Q	probably damaging	Het
Arhgap40	T	A	2: 158,531,925	S209T	probably benign	Het
Arrdc3	C	T	13: 80,889,093	L123F	probably damaging	Het
Aspscr1	A	G	11: 120,689,039	N212D	probably benign	Het
Ccr9	A	T	9: 123,779,306	S18C	probably damaging	Het
Clic4	A	G	4: 135,217,205	Y220H	probably damaging	Het
Cntln	A	C	4: 84,979,340	H388P	possibly damaging	Het
Col12a1	A	G	9: 79,631,643	V2457A	probably damaging	Het
Ctsk	A	G	3: 95,501,614	N103D	probably benign	Het
Ddx60	T	C	8: 61,975,792	S779P	probably damaging	Het
Dnah5	T	A	15: 28,246,232		probably null	Het
Dnah7b	T	A	1: 46,109,302	D279E	probably benign	Het
Fam117a	A	G	11: 95,378,834	N308S	probably benign	Het
Fasn	A	G	11: 120,813,419	V1419A	probably damaging	Het
Fhad1	A	G	4: 141,951,491	S625P	probably benign	Het
Gemin5	A	G	11: 58,147,928	V585A	probably benign	Het
Gm5145	C	A	17: 20,570,384	P8Q	probably benign	Het
Gm8332	T	C	12: 88,249,754	N116S	probably benign	Het
Herc1	C	A	9: 66,416,347	T1381K	probably damaging	Het
Herc6	T	C	6: 57,660,122	I824T	probably damaging	Het
Klrb1	C	T	6: 128,710,087	V161I	probably benign	Het
Krtap31-1	A	G	11: 99,908,432	N154D	not run	Het
Lcp1	A	T	14: 75,200,431	I94F	probably benign	Het
Lin7a	A	T	10: 107,382,691	Q154L	possibly damaging	Het
Lnx1	T	C	5: 74,685,690	Y33C	probably damaging	Het
Myo5b	T	C	18: 74,701,446	V859A	probably benign	Het
Ncbp1	A	G	4: 46,170,015	Q696R	probably damaging	Het
Neurl1b	C	G	17: 26,438,746	H219Q	probably benign	Het
Nme8	T	C	13: 19,658,829	E392G	probably benign	Het
Nufip1	CAAAACAGAAAACAGAAAAC	CAAAACAGAAAACAGAAAACAGAAAAC	14: 76,111,974		probably null	Het
Nuggc	A	G	14: 65,613,526	I298V	probably damaging	Het
Nup155	A	C	15: 8,153,696	K1247Q	probably damaging	Het
Olfr368	A	T	2: 37,331,759	E4V	probably benign	Het
Olfr403	A	G	11: 74,196,207	K235E	probably damaging	Het
Otud4	T	A	8: 79,655,864		probably null	Het
Pcdhb18	T	C	18: 37,491,696	V693A	probably damaging	Het
Pcnx3	A	G	19: 5,677,182	F1108L	probably benign	Het
Prkca	A	T	11: 108,014,344	N189K	probably damaging	Het
Rbm24	A	G	13: 46,429,207	I201V	probably benign	Het
Reep6	T	C	10: 80,333,793	L105P	probably damaging	Het
Retreg1	T	C	15: 25,941,040		probably benign	Het
Rev3l	C	T	10: 39,836,722	T2382I	probably benign	Het
Rnf31	A	G	14: 55,594,361	N230S	probably benign	Het
Rreb1	T	C	13: 37,931,572	L969P	probably benign	Het
Rsph4a	T	A	10: 33,909,033	N313K	probably damaging	Het
Serpina3f	T	A	12: 104,217,266	L129Q	probably damaging	Het
Slc9a2	T	A	1: 40,718,997	V232D	probably damaging	Het
Stmn2	T	C	3: 8,554,865	L121P	probably damaging	Het
Svep1	C	T	4: 58,097,424	G1373D	probably damaging	Het
Tmem206	A	G	1: 191,340,868	N162S	probably benign	Het
Tns1	C	A	1: 73,952,477	R1014L	possibly damaging	Het
Top2b	T	C	14: 16,416,620	S1127P	possibly damaging	Het
Txndc16	A	T	14: 45,135,867	C768*	probably null	Het
Ubl7	A	T	9: 57,929,769	E354D	probably benign	Het
Ush2a	T	C	1: 188,784,708	L3205P	possibly damaging	Het
Xirp2	A	G	2: 67,510,573	T1053A	possibly damaging	Het
Zbtb21	A	G	16: 97,951,877	L402P	probably damaging	Het
Zfp27	T	A	7: 29,894,796	K581N	possibly damaging	Het
Zfp62	A	T	11: 49,215,076		probably benign	Het

Other mutations in Cdc42bpa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Cdc42bpa	APN	1	180106121	missense	probably damaging	1.00
IGL00807:Cdc42bpa	APN	1	180141453	missense	possibly damaging	0.88
IGL00972:Cdc42bpa	APN	1	180074684	missense	probably benign	0.00
IGL01084:Cdc42bpa	APN	1	180142274	splice site	probably benign
IGL01149:Cdc42bpa	APN	1	180074572	missense	probably damaging	0.99
IGL01377:Cdc42bpa	APN	1	180065143	missense	probably damaging	1.00
IGL01541:Cdc42bpa	APN	1	180151158	critical splice acceptor site	probably null
IGL01657:Cdc42bpa	APN	1	180111866	missense	probably benign	0.05
IGL01720:Cdc42bpa	APN	1	180111282	missense	probably damaging	1.00
IGL02227:Cdc42bpa	APN	1	180094424	missense	possibly damaging	0.64
IGL02234:Cdc42bpa	APN	1	180151191	nonsense	probably null
IGL02253:Cdc42bpa	APN	1	180031596	splice site	probably benign
IGL02587:Cdc42bpa	APN	1	180093945	missense	possibly damaging	0.91
IGL02671:Cdc42bpa	APN	1	180061822	missense	probably benign
IGL02746:Cdc42bpa	APN	1	180111747	missense	possibly damaging	0.91
IGL02756:Cdc42bpa	APN	1	180109259	missense	possibly damaging	0.77
IGL02994:Cdc42bpa	APN	1	179999437	missense	probably damaging	1.00
IGL03073:Cdc42bpa	APN	1	180094376	splice site	probably benign
IGL03295:Cdc42bpa	APN	1	180150204	missense	probably benign	0.00
P0022:Cdc42bpa	UTSW	1	179961276	missense	probably damaging	0.99
PIT4142001:Cdc42bpa	UTSW	1	180031560	missense	probably damaging	1.00
R0125:Cdc42bpa	UTSW	1	179961198	missense	probably damaging	1.00
R0268:Cdc42bpa	UTSW	1	180155782	intron	probably benign
R0472:Cdc42bpa	UTSW	1	180040179	missense	probably damaging	1.00
R0492:Cdc42bpa	UTSW	1	180101190	missense	probably benign	0.00
R0609:Cdc42bpa	UTSW	1	180040179	missense	probably damaging	1.00
R0691:Cdc42bpa	UTSW	1	180144835	missense	possibly damaging	0.91
R0738:Cdc42bpa	UTSW	1	179999462	splice site	probably benign
R1547:Cdc42bpa	UTSW	1	180074644	missense	probably damaging	0.99
R1553:Cdc42bpa	UTSW	1	180093975	missense	probably benign	0.01
R1601:Cdc42bpa	UTSW	1	180065001	nonsense	probably null
R1709:Cdc42bpa	UTSW	1	180067224	missense	probably damaging	1.00
R2101:Cdc42bpa	UTSW	1	180146968	missense	probably benign	0.39
R2279:Cdc42bpa	UTSW	1	180036919	missense	probably damaging	0.99
R2357:Cdc42bpa	UTSW	1	180067227	missense	possibly damaging	0.81
R2373:Cdc42bpa	UTSW	1	180111784	missense	possibly damaging	0.78
R2570:Cdc42bpa	UTSW	1	180150177	missense	possibly damaging	0.84
R3709:Cdc42bpa	UTSW	1	180065063	missense	probably damaging	1.00
R3710:Cdc42bpa	UTSW	1	180065063	missense	probably damaging	1.00
R3816:Cdc42bpa	UTSW	1	180144886	missense	possibly damaging	0.80
R3854:Cdc42bpa	UTSW	1	180155978	intron	probably benign
R3855:Cdc42bpa	UTSW	1	180155978	intron	probably benign
R3917:Cdc42bpa	UTSW	1	180106154	critical splice donor site	probably null
R4604:Cdc42bpa	UTSW	1	180109194	missense	probably benign	0.00
R4622:Cdc42bpa	UTSW	1	180074658	missense	probably damaging	0.98
R4664:Cdc42bpa	UTSW	1	180144565	missense	probably damaging	0.99
R4665:Cdc42bpa	UTSW	1	180144565	missense	probably damaging	0.99
R4887:Cdc42bpa	UTSW	1	180144635	missense	possibly damaging	0.61
R4989:Cdc42bpa	UTSW	1	180137801	missense	probably damaging	0.99
R5033:Cdc42bpa	UTSW	1	180065015	missense	probably damaging	1.00
R5050:Cdc42bpa	UTSW	1	180072453	nonsense	probably null
R5077:Cdc42bpa	UTSW	1	180094533	intron	probably benign
R5196:Cdc42bpa	UTSW	1	180072413	missense	probably benign	0.09
R5276:Cdc42bpa	UTSW	1	180137850	missense	probably damaging	1.00
R5313:Cdc42bpa	UTSW	1	180084433	missense	probably benign
R5364:Cdc42bpa	UTSW	1	180067182	missense	probably benign	0.06
R5372:Cdc42bpa	UTSW	1	180064979	missense	probably damaging	1.00
R5405:Cdc42bpa	UTSW	1	180067329	missense	probably damaging	1.00
R5405:Cdc42bpa	UTSW	1	180138520	missense	possibly damaging	0.95
R5646:Cdc42bpa	UTSW	1	180106094	missense	probably damaging	0.99
R5713:Cdc42bpa	UTSW	1	180084410	missense	probably benign	0.03
R6012:Cdc42bpa	UTSW	1	180065090	missense	probably damaging	1.00
R6029:Cdc42bpa	UTSW	1	180111787	missense	probably damaging	1.00
R6378:Cdc42bpa	UTSW	1	180093996	missense	possibly damaging	0.91
R6609:Cdc42bpa	UTSW	1	180101274	critical splice donor site	probably null
R7122:Cdc42bpa	UTSW	1	180065018	missense	probably damaging	1.00
R7289:Cdc42bpa	UTSW	1	180061797	nonsense	probably null
R7912:Cdc42bpa	UTSW	1	180094013	missense	probably damaging	1.00
R8139:Cdc42bpa	UTSW	1	180069319	missense	probably damaging	1.00
R8362:Cdc42bpa	UTSW	1	180162125	missense	probably damaging	0.98
R8378:Cdc42bpa	UTSW	1	180162144	missense	probably damaging	0.98
R8794:Cdc42bpa	UTSW	1	180067251	missense	probably damaging	1.00
R8835:Cdc42bpa	UTSW	1	180069351	missense	probably damaging	1.00
R8896:Cdc42bpa	UTSW	1	180130808	intron	probably benign
R9012:Cdc42bpa	UTSW	1	180031512	missense
R9110:Cdc42bpa	UTSW	1	180117693	missense	possibly damaging	0.67
R9178:Cdc42bpa	UTSW	1	180130836	missense
R9184:Cdc42bpa	UTSW	1	180144736	missense	probably benign	0.13
R9204:Cdc42bpa	UTSW	1	180111895	critical splice donor site	probably null
R9227:Cdc42bpa	UTSW	1	180106073	missense	probably benign
R9230:Cdc42bpa	UTSW	1	180106073	missense	probably benign
R9299:Cdc42bpa	UTSW	1	180144508	missense	probably damaging	1.00
R9366:Cdc42bpa	UTSW	1	180094110	missense	probably damaging	1.00
R9381:Cdc42bpa	UTSW	1	180141483	missense	probably damaging	0.97
R9461:Cdc42bpa	UTSW	1	180142296	missense	probably damaging	1.00
R9559:Cdc42bpa	UTSW	1	180111894	critical splice donor site	probably null
X0026:Cdc42bpa	UTSW	1	179961198	missense	probably damaging	1.00
Z1176:Cdc42bpa	UTSW	1	180065093	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACGCCTACATACATACTGTATATCTC -3'
(R):5'- AGGAGCACTTCTCAACAAAATATAG -3'

Sequencing Primer
(F):5'- CTTTATTAGGTCCAGTCCTC -3'
(R):5'- GAATGATTATCCCCTACTAATCAA -3'

Posted On

2019-11-12