Incidental Mutation 'R7670:Cdc42bpa'
ID592077
Institutional Source Beutler Lab
Gene Symbol Cdc42bpa
Ensembl Gene ENSMUSG00000026490
Gene NameCDC42 binding protein kinase alpha
SynonymsA930014J19Rik, DMPK-like
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R7670 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location179960472-180165603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180065081 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 270 (V270D)
Ref Sequence ENSEMBL: ENSMUSP00000106746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000134959] [ENSMUST00000212756]
Predicted Effect probably damaging
Transcript: ENSMUST00000076687
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: V270D

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 588 N/A INTRINSIC
coiled coil region 632 735 N/A INTRINSIC
Pfam:DMPK_coil 800 860 2.7e-29 PFAM
C1 919 968 4.09e-7 SMART
PH 989 1109 6.02e-8 SMART
CNH 1134 1411 3.37e-17 SMART
low complexity region 1456 1468 N/A INTRINSIC
PBD 1477 1512 2.05e-10 SMART
low complexity region 1531 1546 N/A INTRINSIC
low complexity region 1567 1580 N/A INTRINSIC
low complexity region 1606 1620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097450
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: V270D

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.2e-29 PFAM
C1 1000 1049 4.09e-7 SMART
PH 1070 1190 6.02e-8 SMART
CNH 1215 1492 3.37e-17 SMART
low complexity region 1537 1549 N/A INTRINSIC
PBD 1558 1593 2.05e-10 SMART
low complexity region 1612 1627 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
low complexity region 1687 1701 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097453
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: V270D

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.5e-29 PFAM
C1 972 1021 4.09e-7 SMART
PH 1042 1162 6.02e-8 SMART
CNH 1187 1464 3.37e-17 SMART
low complexity region 1509 1521 N/A INTRINSIC
PBD 1530 1565 2.05e-10 SMART
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1620 1633 N/A INTRINSIC
low complexity region 1659 1673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111117
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: V270D

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134959
SMART Domains Protein: ENSMUSP00000142018
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
PDB:4AW2|A 2 90 1e-58 PDB
SCOP:d1koba_ 50 90 7e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212756
AA Change: V270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Adam26a T A 8: 43,570,153 H100L probably benign Het
Adgrf2 T C 17: 42,711,372 N187S probably damaging Het
Adipoq T A 16: 23,157,582 H244Q probably damaging Het
Arhgap40 T A 2: 158,531,925 S209T probably benign Het
Arrdc3 C T 13: 80,889,093 L123F probably damaging Het
Aspscr1 A G 11: 120,689,039 N212D probably benign Het
Ccr9 A T 9: 123,779,306 S18C probably damaging Het
Clic4 A G 4: 135,217,205 Y220H probably damaging Het
Cntln A C 4: 84,979,340 H388P possibly damaging Het
Col12a1 A G 9: 79,631,643 V2457A probably damaging Het
Ctsk A G 3: 95,501,614 N103D probably benign Het
Ddx60 T C 8: 61,975,792 S779P probably damaging Het
Dnah5 T A 15: 28,246,232 probably null Het
Dnah7b T A 1: 46,109,302 D279E probably benign Het
Fam117a A G 11: 95,378,834 N308S probably benign Het
Fasn A G 11: 120,813,419 V1419A probably damaging Het
Fhad1 A G 4: 141,951,491 S625P probably benign Het
Gemin5 A G 11: 58,147,928 V585A probably benign Het
Gm5145 C A 17: 20,570,384 P8Q probably benign Het
Gm8332 T C 12: 88,249,754 N116S probably benign Het
Herc1 C A 9: 66,416,347 T1381K probably damaging Het
Herc6 T C 6: 57,660,122 I824T probably damaging Het
Klrb1 C T 6: 128,710,087 V161I probably benign Het
Krtap31-1 A G 11: 99,908,432 N154D not run Het
Lcp1 A T 14: 75,200,431 I94F probably benign Het
Lin7a A T 10: 107,382,691 Q154L possibly damaging Het
Lnx1 T C 5: 74,685,690 Y33C probably damaging Het
Myo5b T C 18: 74,701,446 V859A probably benign Het
Ncbp1 A G 4: 46,170,015 Q696R probably damaging Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nme8 T C 13: 19,658,829 E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,111,974 probably null Het
Nuggc A G 14: 65,613,526 I298V probably damaging Het
Nup155 A C 15: 8,153,696 K1247Q probably damaging Het
Olfr368 A T 2: 37,331,759 E4V probably benign Het
Olfr403 A G 11: 74,196,207 K235E probably damaging Het
Otud4 T A 8: 79,655,864 probably null Het
Pcdhb18 T C 18: 37,491,696 V693A probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Prkca A T 11: 108,014,344 N189K probably damaging Het
Rbm24 A G 13: 46,429,207 I201V probably benign Het
Reep6 T C 10: 80,333,793 L105P probably damaging Het
Retreg1 T C 15: 25,941,040 probably benign Het
Rev3l C T 10: 39,836,722 T2382I probably benign Het
Rnf31 A G 14: 55,594,361 N230S probably benign Het
Rreb1 T C 13: 37,931,572 L969P probably benign Het
Rsph4a T A 10: 33,909,033 N313K probably damaging Het
Serpina3f T A 12: 104,217,266 L129Q probably damaging Het
Slc9a2 T A 1: 40,718,997 V232D probably damaging Het
Stmn2 T C 3: 8,554,865 L121P probably damaging Het
Svep1 C T 4: 58,097,424 G1373D probably damaging Het
Tmem206 A G 1: 191,340,868 N162S probably benign Het
Tns1 C A 1: 73,952,477 R1014L possibly damaging Het
Top2b T C 14: 16,416,620 S1127P possibly damaging Het
Txndc16 A T 14: 45,135,867 C768* probably null Het
Ubl7 A T 9: 57,929,769 E354D probably benign Het
Ush2a T C 1: 188,784,708 L3205P possibly damaging Het
Xirp2 A G 2: 67,510,573 T1053A possibly damaging Het
Zbtb21 A G 16: 97,951,877 L402P probably damaging Het
Zfp27 T A 7: 29,894,796 K581N possibly damaging Het
Zfp62 A T 11: 49,215,076 probably benign Het
Other mutations in Cdc42bpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Cdc42bpa APN 1 180106121 missense probably damaging 1.00
IGL00807:Cdc42bpa APN 1 180141453 missense possibly damaging 0.88
IGL00972:Cdc42bpa APN 1 180074684 missense probably benign 0.00
IGL01084:Cdc42bpa APN 1 180142274 splice site probably benign
IGL01149:Cdc42bpa APN 1 180074572 missense probably damaging 0.99
IGL01377:Cdc42bpa APN 1 180065143 missense probably damaging 1.00
IGL01541:Cdc42bpa APN 1 180151158 critical splice acceptor site probably null
IGL01657:Cdc42bpa APN 1 180111866 missense probably benign 0.05
IGL01720:Cdc42bpa APN 1 180111282 missense probably damaging 1.00
IGL02227:Cdc42bpa APN 1 180094424 missense possibly damaging 0.64
IGL02234:Cdc42bpa APN 1 180151191 nonsense probably null
IGL02253:Cdc42bpa APN 1 180031596 splice site probably benign
IGL02587:Cdc42bpa APN 1 180093945 missense possibly damaging 0.91
IGL02671:Cdc42bpa APN 1 180061822 missense probably benign
IGL02746:Cdc42bpa APN 1 180111747 missense possibly damaging 0.91
IGL02756:Cdc42bpa APN 1 180109259 missense possibly damaging 0.77
IGL02994:Cdc42bpa APN 1 179999437 missense probably damaging 1.00
IGL03073:Cdc42bpa APN 1 180094376 splice site probably benign
IGL03295:Cdc42bpa APN 1 180150204 missense probably benign 0.00
P0022:Cdc42bpa UTSW 1 179961276 missense probably damaging 0.99
PIT4142001:Cdc42bpa UTSW 1 180031560 missense probably damaging 1.00
R0125:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
R0268:Cdc42bpa UTSW 1 180155782 intron probably benign
R0472:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0492:Cdc42bpa UTSW 1 180101190 missense probably benign 0.00
R0609:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0691:Cdc42bpa UTSW 1 180144835 missense possibly damaging 0.91
R0738:Cdc42bpa UTSW 1 179999462 splice site probably benign
R1547:Cdc42bpa UTSW 1 180074644 missense probably damaging 0.99
R1553:Cdc42bpa UTSW 1 180093975 missense probably benign 0.01
R1601:Cdc42bpa UTSW 1 180065001 nonsense probably null
R1709:Cdc42bpa UTSW 1 180067224 missense probably damaging 1.00
R2101:Cdc42bpa UTSW 1 180146968 missense probably benign 0.39
R2279:Cdc42bpa UTSW 1 180036919 missense probably damaging 0.99
R2357:Cdc42bpa UTSW 1 180067227 missense possibly damaging 0.81
R2373:Cdc42bpa UTSW 1 180111784 missense possibly damaging 0.78
R2570:Cdc42bpa UTSW 1 180150177 missense possibly damaging 0.84
R3709:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3710:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3816:Cdc42bpa UTSW 1 180144886 missense possibly damaging 0.80
R3854:Cdc42bpa UTSW 1 180155978 intron probably benign
R3855:Cdc42bpa UTSW 1 180155978 intron probably benign
R3917:Cdc42bpa UTSW 1 180106154 critical splice donor site probably null
R4604:Cdc42bpa UTSW 1 180109194 missense probably benign 0.00
R4622:Cdc42bpa UTSW 1 180074658 missense probably damaging 0.98
R4664:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4665:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4887:Cdc42bpa UTSW 1 180144635 missense possibly damaging 0.61
R4989:Cdc42bpa UTSW 1 180137801 missense probably damaging 0.99
R5033:Cdc42bpa UTSW 1 180065015 missense probably damaging 1.00
R5050:Cdc42bpa UTSW 1 180072453 nonsense probably null
R5077:Cdc42bpa UTSW 1 180094533 intron probably benign
R5196:Cdc42bpa UTSW 1 180072413 missense probably benign 0.09
R5276:Cdc42bpa UTSW 1 180137850 missense probably damaging 1.00
R5313:Cdc42bpa UTSW 1 180084433 missense probably benign
R5364:Cdc42bpa UTSW 1 180067182 missense probably benign 0.06
R5372:Cdc42bpa UTSW 1 180064979 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180067329 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180138520 missense possibly damaging 0.95
R5646:Cdc42bpa UTSW 1 180106094 missense probably damaging 0.99
R5713:Cdc42bpa UTSW 1 180084410 missense probably benign 0.03
R6012:Cdc42bpa UTSW 1 180065090 missense probably damaging 1.00
R6029:Cdc42bpa UTSW 1 180111787 missense probably damaging 1.00
R6378:Cdc42bpa UTSW 1 180093996 missense possibly damaging 0.91
R6609:Cdc42bpa UTSW 1 180101274 critical splice donor site probably null
R7122:Cdc42bpa UTSW 1 180065018 missense probably damaging 1.00
R7289:Cdc42bpa UTSW 1 180061797 nonsense probably null
R7912:Cdc42bpa UTSW 1 180094013 missense probably damaging 1.00
R8139:Cdc42bpa UTSW 1 180069319 missense probably damaging 1.00
R8362:Cdc42bpa UTSW 1 180162125 missense probably damaging 0.98
R8378:Cdc42bpa UTSW 1 180162144 missense probably damaging 0.98
X0026:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
Z1176:Cdc42bpa UTSW 1 180065093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGCCTACATACATACTGTATATCTC -3'
(R):5'- AGGAGCACTTCTCAACAAAATATAG -3'

Sequencing Primer
(F):5'- CTTTATTAGGTCCAGTCCTC -3'
(R):5'- GAATGATTATCCCCTACTAATCAA -3'
Posted On2019-11-12