Incidental Mutation 'R7670:Cntln'
ID 592087
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 045742-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R7670 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 84897577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 388 (H388P)
Ref Sequence ENSEMBL: ENSMUSP00000044138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect possibly damaging
Transcript: ENSMUST00000047023
AA Change: H388P

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: H388P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169371
AA Change: H388P

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: H388P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 44,023,190 (GRCm39) H100L probably benign Het
Adgrf2 T C 17: 43,022,263 (GRCm39) N187S probably damaging Het
Adipoq T A 16: 22,976,332 (GRCm39) H244Q probably damaging Het
Arhgap40 T A 2: 158,373,845 (GRCm39) S209T probably benign Het
Arrdc3 C T 13: 81,037,212 (GRCm39) L123F probably damaging Het
Aspscr1 A G 11: 120,579,865 (GRCm39) N212D probably benign Het
Ccr9 A T 9: 123,608,371 (GRCm39) S18C probably damaging Het
Cdc42bpa T A 1: 179,892,646 (GRCm39) V270D probably damaging Het
Clic4 A G 4: 134,944,516 (GRCm39) Y220H probably damaging Het
Col12a1 A G 9: 79,538,925 (GRCm39) V2457A probably damaging Het
Ctsk A G 3: 95,408,925 (GRCm39) N103D probably benign Het
Ddx60 T C 8: 62,428,826 (GRCm39) S779P probably damaging Het
Dnah5 T A 15: 28,246,378 (GRCm39) probably null Het
Dnah7b T A 1: 46,148,462 (GRCm39) D279E probably benign Het
Eif1ad10 T C 12: 88,216,524 (GRCm39) N116S probably benign Het
Fam117a A G 11: 95,269,660 (GRCm39) N308S probably benign Het
Fasn A G 11: 120,704,245 (GRCm39) V1419A probably damaging Het
Fhad1 A G 4: 141,678,802 (GRCm39) S625P probably benign Het
Gemin5 A G 11: 58,038,754 (GRCm39) V585A probably benign Het
Gm5145 C A 17: 20,790,646 (GRCm39) P8Q probably benign Het
Herc1 C A 9: 66,323,629 (GRCm39) T1381K probably damaging Het
Herc6 T C 6: 57,637,107 (GRCm39) I824T probably damaging Het
Klrb1 C T 6: 128,687,050 (GRCm39) V161I probably benign Het
Krtap31-1 A G 11: 99,799,258 (GRCm39) N154D not run Het
Lcp1 A T 14: 75,437,871 (GRCm39) I94F probably benign Het
Lin7a A T 10: 107,218,552 (GRCm39) Q154L possibly damaging Het
Lnx1 T C 5: 74,846,351 (GRCm39) Y33C probably damaging Het
Myo5b T C 18: 74,834,517 (GRCm39) V859A probably benign Het
Ncbp1 A G 4: 46,170,015 (GRCm39) Q696R probably damaging Het
Neurl1b C G 17: 26,657,720 (GRCm39) H219Q probably benign Het
Nme8 T C 13: 19,842,999 (GRCm39) E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,349,414 (GRCm39) probably null Het
Nuggc A G 14: 65,850,975 (GRCm39) I298V probably damaging Het
Nup155 A C 15: 8,183,180 (GRCm39) K1247Q probably damaging Het
Or1a1 A G 11: 74,087,033 (GRCm39) K235E probably damaging Het
Or5c1 A T 2: 37,221,771 (GRCm39) E4V probably benign Het
Otud4 T A 8: 80,382,493 (GRCm39) probably null Het
Pacc1 A G 1: 191,073,065 (GRCm39) N162S probably benign Het
Pcdhb18 T C 18: 37,624,749 (GRCm39) V693A probably damaging Het
Pcnx3 A G 19: 5,727,210 (GRCm39) F1108L probably benign Het
Prkca A T 11: 107,905,170 (GRCm39) N189K probably damaging Het
Rbm24 A G 13: 46,582,683 (GRCm39) I201V probably benign Het
Reep6 T C 10: 80,169,627 (GRCm39) L105P probably damaging Het
Retreg1 T C 15: 25,941,126 (GRCm39) probably benign Het
Rev3l C T 10: 39,712,718 (GRCm39) T2382I probably benign Het
Rnf31 A G 14: 55,831,818 (GRCm39) N230S probably benign Het
Rreb1 T C 13: 38,115,548 (GRCm39) L969P probably benign Het
Rsph4a T A 10: 33,785,029 (GRCm39) N313K probably damaging Het
Serpina3f T A 12: 104,183,525 (GRCm39) L129Q probably damaging Het
Slc9a2 T A 1: 40,758,157 (GRCm39) V232D probably damaging Het
Stmn2 T C 3: 8,619,925 (GRCm39) L121P probably damaging Het
Svep1 C T 4: 58,097,424 (GRCm39) G1373D probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Tns1 C A 1: 73,991,636 (GRCm39) R1014L possibly damaging Het
Top2b T C 14: 16,416,620 (GRCm38) S1127P possibly damaging Het
Txndc16 A T 14: 45,373,324 (GRCm39) C768* probably null Het
Ubl7 A T 9: 57,837,052 (GRCm39) E354D probably benign Het
Ush2a T C 1: 188,516,905 (GRCm39) L3205P possibly damaging Het
Xirp2 A G 2: 67,340,917 (GRCm39) T1053A possibly damaging Het
Zbtb21 A G 16: 97,753,077 (GRCm39) L402P probably damaging Het
Zfp27 T A 7: 29,594,221 (GRCm39) K581N possibly damaging Het
Zfp62 A T 11: 49,105,903 (GRCm39) probably benign Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCAATAACACGTTGTACATTTTG -3'
(R):5'- GGAAATCTCTCACCTTTCCTGAGTG -3'

Sequencing Primer
(F):5'- AGAGCAGGTATATGTCCATA -3'
(R):5'- TCCTGAGTGGCTTGAATCAC -3'
Posted On 2019-11-12