Mutagenetix > Incidental Mutation

Incidental Mutation 'R7670:Lnx1'

592090

Institutional Source

Beutler Lab

Gene Symbol

Lnx1

Ensembl Gene

ENSMUSG00000029228

Gene Name

ligand of numb-protein X 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R7670 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74592447-74702912 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74685690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 33 (Y33C)

Ref Sequence

ENSEMBL: ENSMUSP00000113035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087161] [ENSMUST00000117388]

AlphaFold

O70263

Predicted Effect

probably damaging
Transcript: ENSMUST00000087161
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228
AA Change: Y33C

Domain	Start	End	E-Value	Type
RING	45	82	5.82e-6	SMART
low complexity region	97	107	N/A	INTRINSIC
Blast:PDZ	157	264	3e-33	BLAST
PDZ	288	363	5.33e-19	SMART
PDZ	395	468	2.27e-13	SMART
PDZ	517	594	8.27e-16	SMART
PDZ	647	724	5.71e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117388
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228
AA Change: Y33C

Domain	Start	End	E-Value	Type
RING	45	82	5.82e-6	SMART
low complexity region	97	107	N/A	INTRINSIC
Blast:PDZ	157	264	3e-33	BLAST
PDZ	288	363	5.33e-19	SMART
PDZ	395	468	2.27e-13	SMART
PDZ	517	594	8.27e-16	SMART
PDZ	647	724	5.71e-19	SMART

Meta Mutation Damage Score

0.8793

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
Adam26a	T	A	8: 43,570,153	H100L	probably benign	Het
Adgrf2	T	C	17: 42,711,372	N187S	probably damaging	Het
Adipoq	T	A	16: 23,157,582	H244Q	probably damaging	Het
Arhgap40	T	A	2: 158,531,925	S209T	probably benign	Het
Arrdc3	C	T	13: 80,889,093	L123F	probably damaging	Het
Aspscr1	A	G	11: 120,689,039	N212D	probably benign	Het
Ccr9	A	T	9: 123,779,306	S18C	probably damaging	Het
Cdc42bpa	T	A	1: 180,065,081	V270D	probably damaging	Het
Clic4	A	G	4: 135,217,205	Y220H	probably damaging	Het
Cntln	A	C	4: 84,979,340	H388P	possibly damaging	Het
Col12a1	A	G	9: 79,631,643	V2457A	probably damaging	Het
Ctsk	A	G	3: 95,501,614	N103D	probably benign	Het
Ddx60	T	C	8: 61,975,792	S779P	probably damaging	Het
Dnah5	T	A	15: 28,246,232		probably null	Het
Dnah7b	T	A	1: 46,109,302	D279E	probably benign	Het
Fam117a	A	G	11: 95,378,834	N308S	probably benign	Het
Fasn	A	G	11: 120,813,419	V1419A	probably damaging	Het
Fhad1	A	G	4: 141,951,491	S625P	probably benign	Het
Gemin5	A	G	11: 58,147,928	V585A	probably benign	Het
Gm5145	C	A	17: 20,570,384	P8Q	probably benign	Het
Gm8332	T	C	12: 88,249,754	N116S	probably benign	Het
Herc1	C	A	9: 66,416,347	T1381K	probably damaging	Het
Herc6	T	C	6: 57,660,122	I824T	probably damaging	Het
Klrb1	C	T	6: 128,710,087	V161I	probably benign	Het
Krtap31-1	A	G	11: 99,908,432	N154D	not run	Het
Lcp1	A	T	14: 75,200,431	I94F	probably benign	Het
Lin7a	A	T	10: 107,382,691	Q154L	possibly damaging	Het
Myo5b	T	C	18: 74,701,446	V859A	probably benign	Het
Ncbp1	A	G	4: 46,170,015	Q696R	probably damaging	Het
Neurl1b	C	G	17: 26,438,746	H219Q	probably benign	Het
Nme8	T	C	13: 19,658,829	E392G	probably benign	Het
Nufip1	CAAAACAGAAAACAGAAAAC	CAAAACAGAAAACAGAAAACAGAAAAC	14: 76,111,974		probably null	Het
Nuggc	A	G	14: 65,613,526	I298V	probably damaging	Het
Nup155	A	C	15: 8,153,696	K1247Q	probably damaging	Het
Olfr368	A	T	2: 37,331,759	E4V	probably benign	Het
Olfr403	A	G	11: 74,196,207	K235E	probably damaging	Het
Otud4	T	A	8: 79,655,864		probably null	Het
Pcdhb18	T	C	18: 37,491,696	V693A	probably damaging	Het
Pcnx3	A	G	19: 5,677,182	F1108L	probably benign	Het
Prkca	A	T	11: 108,014,344	N189K	probably damaging	Het
Rbm24	A	G	13: 46,429,207	I201V	probably benign	Het
Reep6	T	C	10: 80,333,793	L105P	probably damaging	Het
Retreg1	T	C	15: 25,941,040		probably benign	Het
Rev3l	C	T	10: 39,836,722	T2382I	probably benign	Het
Rnf31	A	G	14: 55,594,361	N230S	probably benign	Het
Rreb1	T	C	13: 37,931,572	L969P	probably benign	Het
Rsph4a	T	A	10: 33,909,033	N313K	probably damaging	Het
Serpina3f	T	A	12: 104,217,266	L129Q	probably damaging	Het
Slc9a2	T	A	1: 40,718,997	V232D	probably damaging	Het
Stmn2	T	C	3: 8,554,865	L121P	probably damaging	Het
Svep1	C	T	4: 58,097,424	G1373D	probably damaging	Het
Tmem206	A	G	1: 191,340,868	N162S	probably benign	Het
Tns1	C	A	1: 73,952,477	R1014L	possibly damaging	Het
Top2b	T	C	14: 16,416,620	S1127P	possibly damaging	Het
Txndc16	A	T	14: 45,135,867	C768*	probably null	Het
Ubl7	A	T	9: 57,929,769	E354D	probably benign	Het
Ush2a	T	C	1: 188,784,708	L3205P	possibly damaging	Het
Xirp2	A	G	2: 67,510,573	T1053A	possibly damaging	Het
Zbtb21	A	G	16: 97,951,877	L402P	probably damaging	Het
Zfp27	T	A	7: 29,894,796	K581N	possibly damaging	Het
Zfp62	A	T	11: 49,215,076		probably benign	Het

Other mutations in Lnx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Lnx1	APN	5	74685717	missense	probably benign	0.00
IGL01538:Lnx1	APN	5	74620155	missense	possibly damaging	0.50
IGL02351:Lnx1	APN	5	74627366	missense	probably damaging	0.97
IGL02358:Lnx1	APN	5	74627366	missense	probably damaging	0.97
IGL03011:Lnx1	APN	5	74685759	missense	probably benign	0.02
IGL03188:Lnx1	APN	5	74620263	missense	probably damaging	1.00
bobcat	UTSW	5	74685690	missense	probably damaging	1.00
Caracal	UTSW	5	74606049	missense	probably damaging	1.00
R0490:Lnx1	UTSW	5	74620347	critical splice acceptor site	probably null
R0714:Lnx1	UTSW	5	74607909	splice site	probably benign
R1343:Lnx1	UTSW	5	74597379	missense	probably damaging	0.98
R1533:Lnx1	UTSW	5	74620017	missense	probably damaging	1.00
R1681:Lnx1	UTSW	5	74685410	missense	probably benign
R1714:Lnx1	UTSW	5	74607737	missense	probably null	1.00
R1727:Lnx1	UTSW	5	74607916	splice site	probably null
R1806:Lnx1	UTSW	5	74606049	missense	probably damaging	1.00
R2091:Lnx1	UTSW	5	74620066	missense	probably benign	0.25
R2879:Lnx1	UTSW	5	74620123	missense	probably benign	0.03
R2984:Lnx1	UTSW	5	74685422	nonsense	probably null
R3790:Lnx1	UTSW	5	74628366	splice site	probably benign
R3953:Lnx1	UTSW	5	74606089	missense	probably benign
R4509:Lnx1	UTSW	5	74620192	missense	probably damaging	1.00
R4510:Lnx1	UTSW	5	74620192	missense	probably damaging	1.00
R4511:Lnx1	UTSW	5	74620192	missense	probably damaging	1.00
R4575:Lnx1	UTSW	5	74685543	missense	probably damaging	1.00
R4583:Lnx1	UTSW	5	74610796	missense	probably benign	0.16
R4624:Lnx1	UTSW	5	74660460	intron	probably benign
R4647:Lnx1	UTSW	5	74610796	missense	probably benign	0.16
R4648:Lnx1	UTSW	5	74610796	missense	probably benign	0.16
R4877:Lnx1	UTSW	5	74628123	missense	probably benign	0.01
R4883:Lnx1	UTSW	5	74607869	missense	probably benign
R5256:Lnx1	UTSW	5	74685654	missense	probably damaging	1.00
R6169:Lnx1	UTSW	5	74677569	missense	probably damaging	1.00
R6185:Lnx1	UTSW	5	74685608	nonsense	probably null
R6408:Lnx1	UTSW	5	74685646	missense	probably damaging	1.00
R6476:Lnx1	UTSW	5	74607880	missense	possibly damaging	0.52
R7083:Lnx1	UTSW	5	74628185	missense	possibly damaging	0.94
R7085:Lnx1	UTSW	5	74628185	missense	possibly damaging	0.94
R7261:Lnx1	UTSW	5	74677514	nonsense	probably null
R7511:Lnx1	UTSW	5	74620311	missense	probably benign	0.01
R7574:Lnx1	UTSW	5	74685438	missense	probably benign	0.33
R8145:Lnx1	UTSW	5	74685399	missense	probably benign	0.22
R9015:Lnx1	UTSW	5	74620122	missense	probably benign	0.00
R9224:Lnx1	UTSW	5	74606149	missense	probably benign	0.37
R9321:Lnx1	UTSW	5	74620330	missense	probably damaging	1.00
R9340:Lnx1	UTSW	5	74597923	missense	probably benign	0.01
R9704:Lnx1	UTSW	5	74620218	missense	probably benign	0.02
Z1177:Lnx1	UTSW	5	74627441	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TGACCAAGATACTGGATTTCTTGC -3'
(R):5'- ATGGTGTGATCATGAGCTGC -3'

Sequencing Primer
(F):5'- CAGTGCTGCAGAACCACAGG -3'
(R):5'- TGATCATGAGCTGCCTTGTTC -3'

Posted On

2019-11-12