Incidental Mutation 'R7670:Zfp27'
ID 592093
Institutional Source Beutler Lab
Gene Symbol Zfp27
Ensembl Gene ENSMUSG00000062040
Gene Name zinc finger protein 27
Synonyms Zfp-27, mkr-4
MMRRC Submission 045742-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.611) question?
Stock # R7670 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 29592758-29605997 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29594221 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 581 (K581N)
Ref Sequence ENSEMBL: ENSMUSP00000054012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053521] [ENSMUST00000159920] [ENSMUST00000161904] [ENSMUST00000162592] [ENSMUST00000172448]
AlphaFold P10077
Predicted Effect possibly damaging
Transcript: ENSMUST00000053521
AA Change: K581N

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054012
Gene: ENSMUSG00000062040
AA Change: K581N

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159920
AA Change: K581N

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125232
Gene: ENSMUSG00000062040
AA Change: K581N

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161904
AA Change: K581N

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124684
Gene: ENSMUSG00000062040
AA Change: K581N

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162592
AA Change: K581N

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123953
Gene: ENSMUSG00000062040
AA Change: K581N

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172448
AA Change: K581N

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127677
Gene: ENSMUSG00000062040
AA Change: K581N

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 44,023,190 (GRCm39) H100L probably benign Het
Adgrf2 T C 17: 43,022,263 (GRCm39) N187S probably damaging Het
Adipoq T A 16: 22,976,332 (GRCm39) H244Q probably damaging Het
Arhgap40 T A 2: 158,373,845 (GRCm39) S209T probably benign Het
Arrdc3 C T 13: 81,037,212 (GRCm39) L123F probably damaging Het
Aspscr1 A G 11: 120,579,865 (GRCm39) N212D probably benign Het
Ccr9 A T 9: 123,608,371 (GRCm39) S18C probably damaging Het
Cdc42bpa T A 1: 179,892,646 (GRCm39) V270D probably damaging Het
Clic4 A G 4: 134,944,516 (GRCm39) Y220H probably damaging Het
Cntln A C 4: 84,897,577 (GRCm39) H388P possibly damaging Het
Col12a1 A G 9: 79,538,925 (GRCm39) V2457A probably damaging Het
Ctsk A G 3: 95,408,925 (GRCm39) N103D probably benign Het
Ddx60 T C 8: 62,428,826 (GRCm39) S779P probably damaging Het
Dnah5 T A 15: 28,246,378 (GRCm39) probably null Het
Dnah7b T A 1: 46,148,462 (GRCm39) D279E probably benign Het
Eif1ad10 T C 12: 88,216,524 (GRCm39) N116S probably benign Het
Fam117a A G 11: 95,269,660 (GRCm39) N308S probably benign Het
Fasn A G 11: 120,704,245 (GRCm39) V1419A probably damaging Het
Fhad1 A G 4: 141,678,802 (GRCm39) S625P probably benign Het
Gemin5 A G 11: 58,038,754 (GRCm39) V585A probably benign Het
Gm5145 C A 17: 20,790,646 (GRCm39) P8Q probably benign Het
Herc1 C A 9: 66,323,629 (GRCm39) T1381K probably damaging Het
Herc6 T C 6: 57,637,107 (GRCm39) I824T probably damaging Het
Klrb1 C T 6: 128,687,050 (GRCm39) V161I probably benign Het
Krtap31-1 A G 11: 99,799,258 (GRCm39) N154D not run Het
Lcp1 A T 14: 75,437,871 (GRCm39) I94F probably benign Het
Lin7a A T 10: 107,218,552 (GRCm39) Q154L possibly damaging Het
Lnx1 T C 5: 74,846,351 (GRCm39) Y33C probably damaging Het
Myo5b T C 18: 74,834,517 (GRCm39) V859A probably benign Het
Ncbp1 A G 4: 46,170,015 (GRCm39) Q696R probably damaging Het
Neurl1b C G 17: 26,657,720 (GRCm39) H219Q probably benign Het
Nme8 T C 13: 19,842,999 (GRCm39) E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,349,414 (GRCm39) probably null Het
Nuggc A G 14: 65,850,975 (GRCm39) I298V probably damaging Het
Nup155 A C 15: 8,183,180 (GRCm39) K1247Q probably damaging Het
Or1a1 A G 11: 74,087,033 (GRCm39) K235E probably damaging Het
Or5c1 A T 2: 37,221,771 (GRCm39) E4V probably benign Het
Otud4 T A 8: 80,382,493 (GRCm39) probably null Het
Pacc1 A G 1: 191,073,065 (GRCm39) N162S probably benign Het
Pcdhb18 T C 18: 37,624,749 (GRCm39) V693A probably damaging Het
Pcnx3 A G 19: 5,727,210 (GRCm39) F1108L probably benign Het
Prkca A T 11: 107,905,170 (GRCm39) N189K probably damaging Het
Rbm24 A G 13: 46,582,683 (GRCm39) I201V probably benign Het
Reep6 T C 10: 80,169,627 (GRCm39) L105P probably damaging Het
Retreg1 T C 15: 25,941,126 (GRCm39) probably benign Het
Rev3l C T 10: 39,712,718 (GRCm39) T2382I probably benign Het
Rnf31 A G 14: 55,831,818 (GRCm39) N230S probably benign Het
Rreb1 T C 13: 38,115,548 (GRCm39) L969P probably benign Het
Rsph4a T A 10: 33,785,029 (GRCm39) N313K probably damaging Het
Serpina3f T A 12: 104,183,525 (GRCm39) L129Q probably damaging Het
Slc9a2 T A 1: 40,758,157 (GRCm39) V232D probably damaging Het
Stmn2 T C 3: 8,619,925 (GRCm39) L121P probably damaging Het
Svep1 C T 4: 58,097,424 (GRCm39) G1373D probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Tns1 C A 1: 73,991,636 (GRCm39) R1014L possibly damaging Het
Top2b T C 14: 16,416,620 (GRCm38) S1127P possibly damaging Het
Txndc16 A T 14: 45,373,324 (GRCm39) C768* probably null Het
Ubl7 A T 9: 57,837,052 (GRCm39) E354D probably benign Het
Ush2a T C 1: 188,516,905 (GRCm39) L3205P possibly damaging Het
Xirp2 A G 2: 67,340,917 (GRCm39) T1053A possibly damaging Het
Zbtb21 A G 16: 97,753,077 (GRCm39) L402P probably damaging Het
Zfp62 A T 11: 49,105,903 (GRCm39) probably benign Het
Other mutations in Zfp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Zfp27 APN 7 29,594,383 (GRCm39) missense probably damaging 0.97
IGL02490:Zfp27 APN 7 29,594,360 (GRCm39) missense possibly damaging 0.73
IGL02899:Zfp27 APN 7 29,595,680 (GRCm39) missense possibly damaging 0.91
R0179:Zfp27 UTSW 7 29,595,850 (GRCm39) missense possibly damaging 0.51
R0234:Zfp27 UTSW 7 29,593,532 (GRCm39) missense possibly damaging 0.73
R0234:Zfp27 UTSW 7 29,593,532 (GRCm39) missense possibly damaging 0.73
R0511:Zfp27 UTSW 7 29,593,947 (GRCm39) missense probably damaging 0.97
R1185:Zfp27 UTSW 7 29,595,254 (GRCm39) missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29,595,254 (GRCm39) missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29,595,254 (GRCm39) missense possibly damaging 0.92
R1294:Zfp27 UTSW 7 29,595,737 (GRCm39) missense possibly damaging 0.53
R1581:Zfp27 UTSW 7 29,595,549 (GRCm39) missense possibly damaging 0.53
R1763:Zfp27 UTSW 7 29,594,801 (GRCm39) missense possibly damaging 0.96
R2083:Zfp27 UTSW 7 29,594,208 (GRCm39) missense probably benign 0.06
R2217:Zfp27 UTSW 7 29,595,536 (GRCm39) missense possibly damaging 0.96
R2696:Zfp27 UTSW 7 29,595,792 (GRCm39) missense possibly damaging 0.85
R4084:Zfp27 UTSW 7 29,594,792 (GRCm39) missense possibly damaging 0.91
R4864:Zfp27 UTSW 7 29,594,261 (GRCm39) missense probably damaging 0.99
R6057:Zfp27 UTSW 7 29,594,444 (GRCm39) missense possibly damaging 0.83
R6063:Zfp27 UTSW 7 29,593,727 (GRCm39) missense probably damaging 0.97
R6553:Zfp27 UTSW 7 29,595,818 (GRCm39) missense possibly damaging 0.86
R6585:Zfp27 UTSW 7 29,595,818 (GRCm39) missense possibly damaging 0.86
R6800:Zfp27 UTSW 7 29,593,860 (GRCm39) missense probably benign 0.19
R7051:Zfp27 UTSW 7 29,594,446 (GRCm39) small deletion probably benign
R7052:Zfp27 UTSW 7 29,594,446 (GRCm39) small deletion probably benign
R7066:Zfp27 UTSW 7 29,594,446 (GRCm39) small deletion probably benign
R7106:Zfp27 UTSW 7 29,594,446 (GRCm39) small deletion probably benign
R7432:Zfp27 UTSW 7 29,594,784 (GRCm39) missense probably benign 0.33
R7473:Zfp27 UTSW 7 29,595,324 (GRCm39) missense possibly damaging 0.71
R7739:Zfp27 UTSW 7 29,593,699 (GRCm39) missense possibly damaging 0.93
R7817:Zfp27 UTSW 7 29,595,815 (GRCm39) missense possibly damaging 0.96
R8750:Zfp27 UTSW 7 29,594,804 (GRCm39) missense possibly damaging 0.53
R8819:Zfp27 UTSW 7 29,594,013 (GRCm39) missense probably benign 0.15
R8820:Zfp27 UTSW 7 29,594,013 (GRCm39) missense probably benign 0.15
R9189:Zfp27 UTSW 7 29,595,359 (GRCm39) missense possibly damaging 0.76
R9511:Zfp27 UTSW 7 29,593,641 (GRCm39) missense possibly damaging 0.71
R9705:Zfp27 UTSW 7 29,595,342 (GRCm39) missense possibly damaging 0.93
Z1177:Zfp27 UTSW 7 29,595,657 (GRCm39) missense possibly damaging 0.72
Z1177:Zfp27 UTSW 7 29,594,586 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GGACTTGCGGATGAAAGCTC -3'
(R):5'- AAAGGGCACACTTGGATGC -3'

Sequencing Primer
(F):5'- GATGAAAGCTCGCCCGCAC -3'
(R):5'- ACCCTATGTGTGCAGTAACTG -3'
Posted On 2019-11-12