Incidental Mutation 'R7670:Col12a1'
ID592098
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Namecollagen, type XII, alpha 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R7670 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location79598991-79718831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79631643 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2457 (V2457A)
Ref Sequence ENSEMBL: ENSMUSP00000071662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
Predicted Effect probably damaging
Transcript: ENSMUST00000071750
AA Change: V2457A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: V2457A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121227
AA Change: V2457A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: V2457A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Adam26a T A 8: 43,570,153 H100L probably benign Het
Adgrf2 T C 17: 42,711,372 N187S probably damaging Het
Adipoq T A 16: 23,157,582 H244Q probably damaging Het
Arhgap40 T A 2: 158,531,925 S209T probably benign Het
Arrdc3 C T 13: 80,889,093 L123F probably damaging Het
Aspscr1 A G 11: 120,689,039 N212D probably benign Het
Ccr9 A T 9: 123,779,306 S18C probably damaging Het
Cdc42bpa T A 1: 180,065,081 V270D probably damaging Het
Clic4 A G 4: 135,217,205 Y220H probably damaging Het
Cntln A C 4: 84,979,340 H388P possibly damaging Het
Ctsk A G 3: 95,501,614 N103D probably benign Het
Ddx60 T C 8: 61,975,792 S779P probably damaging Het
Dnah5 T A 15: 28,246,232 probably null Het
Dnah7b T A 1: 46,109,302 D279E probably benign Het
Fam117a A G 11: 95,378,834 N308S probably benign Het
Fasn A G 11: 120,813,419 V1419A probably damaging Het
Fhad1 A G 4: 141,951,491 S625P probably benign Het
Gemin5 A G 11: 58,147,928 V585A probably benign Het
Gm5145 C A 17: 20,570,384 P8Q probably benign Het
Gm8332 T C 12: 88,249,754 N116S probably benign Het
Herc1 C A 9: 66,416,347 T1381K probably damaging Het
Herc6 T C 6: 57,660,122 I824T probably damaging Het
Klrb1 C T 6: 128,710,087 V161I probably benign Het
Krtap31-1 A G 11: 99,908,432 N154D not run Het
Lcp1 A T 14: 75,200,431 I94F probably benign Het
Lin7a A T 10: 107,382,691 Q154L possibly damaging Het
Lnx1 T C 5: 74,685,690 Y33C probably damaging Het
Myo5b T C 18: 74,701,446 V859A probably benign Het
Ncbp1 A G 4: 46,170,015 Q696R probably damaging Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nme8 T C 13: 19,658,829 E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,111,974 probably null Het
Nuggc A G 14: 65,613,526 I298V probably damaging Het
Nup155 A C 15: 8,153,696 K1247Q probably damaging Het
Olfr368 A T 2: 37,331,759 E4V probably benign Het
Olfr403 A G 11: 74,196,207 K235E probably damaging Het
Otud4 T A 8: 79,655,864 probably null Het
Pcdhb18 T C 18: 37,491,696 V693A probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Prkca A T 11: 108,014,344 N189K probably damaging Het
Rbm24 A G 13: 46,429,207 I201V probably benign Het
Reep6 T C 10: 80,333,793 L105P probably damaging Het
Retreg1 T C 15: 25,941,040 probably benign Het
Rev3l C T 10: 39,836,722 T2382I probably benign Het
Rnf31 A G 14: 55,594,361 N230S probably benign Het
Rreb1 T C 13: 37,931,572 L969P probably benign Het
Rsph4a T A 10: 33,909,033 N313K probably damaging Het
Serpina3f T A 12: 104,217,266 L129Q probably damaging Het
Slc9a2 T A 1: 40,718,997 V232D probably damaging Het
Stmn2 T C 3: 8,554,865 L121P probably damaging Het
Svep1 C T 4: 58,097,424 G1373D probably damaging Het
Tmem206 A G 1: 191,340,868 N162S probably benign Het
Tns1 C A 1: 73,952,477 R1014L possibly damaging Het
Top2b T C 14: 16,416,620 S1127P possibly damaging Het
Txndc16 A T 14: 45,135,867 C768* probably null Het
Ubl7 A T 9: 57,929,769 E354D probably benign Het
Ush2a T C 1: 188,784,708 L3205P possibly damaging Het
Xirp2 A G 2: 67,510,573 T1053A possibly damaging Het
Zbtb21 A G 16: 97,951,877 L402P probably damaging Het
Zfp27 T A 7: 29,894,796 K581N possibly damaging Het
Zfp62 A T 11: 49,215,076 probably benign Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79681537 missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79653332 missense probably benign 0.27
IGL00465:Col12a1 APN 9 79697581 missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79651477 missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79647652 missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79692226 missense probably benign 0.05
IGL01015:Col12a1 APN 9 79633741 missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79703847 missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79678053 missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79643926 missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79657366 missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79601169 makesense probably null
IGL01878:Col12a1 APN 9 79649975 missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79650017 missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79692372 missense probably benign 0.06
IGL02123:Col12a1 APN 9 79662458 critical splice donor site probably null
IGL02312:Col12a1 APN 9 79681515 missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79616021 critical splice donor site probably null
IGL02328:Col12a1 APN 9 79682066 missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79649896 splice site probably null
IGL02355:Col12a1 APN 9 79630711 splice site probably benign
IGL02362:Col12a1 APN 9 79630711 splice site probably benign
IGL02396:Col12a1 APN 9 79662583 missense probably benign
IGL02449:Col12a1 APN 9 79641469 missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79699341 missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79613859 unclassified probably benign
IGL02801:Col12a1 APN 9 79608414 splice site probably null
IGL03001:Col12a1 APN 9 79633673 missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79641551 missense probably benign 0.40
IGL03090:Col12a1 APN 9 79678370 missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79681437 missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79699483 missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79678383 splice site probably null
IGL03348:Col12a1 APN 9 79693430 missense possibly damaging 0.88
Feast UTSW 9 79700262 missense probably benign 0.00
hardly UTSW 9 79700350 nonsense probably null
hearty UTSW 9 79643966 missense probably damaging 1.00
Hefty UTSW 9 79662454 splice site probably benign
P0045:Col12a1 UTSW 9 79647611 missense probably damaging 0.99
PIT4260001:Col12a1 UTSW 9 79651380 critical splice donor site probably null
PIT4280001:Col12a1 UTSW 9 79678105 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0240:Col12a1 UTSW 9 79652033 missense probably benign 0.02
R0276:Col12a1 UTSW 9 79630741 nonsense probably null
R0309:Col12a1 UTSW 9 79600011 unclassified probably null
R0336:Col12a1 UTSW 9 79702345 missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79693494 missense probably benign 0.10
R0413:Col12a1 UTSW 9 79699360 missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79681468 missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79605328 critical splice donor site probably null
R0610:Col12a1 UTSW 9 79707848 missense probably benign
R0631:Col12a1 UTSW 9 79703376 missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79656735 missense probably benign 0.00
R0667:Col12a1 UTSW 9 79628462 missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79652035 missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79612419 missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79681374 splice site probably benign
R0787:Col12a1 UTSW 9 79638485 missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79700402 missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79684253 missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79699723 missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79620089 missense probably benign 0.09
R1321:Col12a1 UTSW 9 79617709 nonsense probably null
R1344:Col12a1 UTSW 9 79699555 nonsense probably null
R1387:Col12a1 UTSW 9 79681375 splice site probably benign
R1511:Col12a1 UTSW 9 79699552 missense probably benign 0.02
R1523:Col12a1 UTSW 9 79660996 missense probably benign 0.01
R1526:Col12a1 UTSW 9 79656798 missense probably benign 0.44
R1564:Col12a1 UTSW 9 79613840 missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79602254 missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79612962 missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79693538 missense probably benign 0.00
R1730:Col12a1 UTSW 9 79628378 missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79703451 missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79633468 missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79672997 missense probably benign 0.01
R1778:Col12a1 UTSW 9 79604585 splice site probably benign
R1845:Col12a1 UTSW 9 79697541 missense probably benign 0.09
R1864:Col12a1 UTSW 9 79627103 splice site probably null
R1876:Col12a1 UTSW 9 79678281 nonsense probably null
R1934:Col12a1 UTSW 9 79604522 nonsense probably null
R1942:Col12a1 UTSW 9 79635466 missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79630549 missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79645793 critical splice acceptor site probably null
R2061:Col12a1 UTSW 9 79617705 missense possibly damaging 0.88
R2064:Col12a1 UTSW 9 79662454 splice site probably benign
R2070:Col12a1 UTSW 9 79647696 missense probably benign 0.00
R2112:Col12a1 UTSW 9 79643899 missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79692352 missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79635427 missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79633657 missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79656813 missense probably benign 0.03
R2425:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79602251 missense probably benign 0.30
R2437:Col12a1 UTSW 9 79692219 missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79697401 missense probably null 0.99
R2851:Col12a1 UTSW 9 79678332 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79700265 missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79643947 missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79680311 missense probably benign
R3430:Col12a1 UTSW 9 79680311 missense probably benign
R3547:Col12a1 UTSW 9 79633416 missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79639723 missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79702364 missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79700389 missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79630741 nonsense probably null
R4392:Col12a1 UTSW 9 79662488 missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79639965 critical splice donor site probably null
R4465:Col12a1 UTSW 9 79672910 missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79633357 missense probably benign 0.00
R4612:Col12a1 UTSW 9 79616057 missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79647601 missense probably benign 0.03
R4649:Col12a1 UTSW 9 79639794 missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79699282 missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79652086 splice site probably null
R4761:Col12a1 UTSW 9 79657310 missense probably benign 0.34
R4784:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79693567 missense probably benign 0.10
R4821:Col12a1 UTSW 9 79715340 intron probably benign
R4925:Col12a1 UTSW 9 79674795 missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79700350 nonsense probably null
R5034:Col12a1 UTSW 9 79657367 missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79605174 missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79643966 missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79706300 missense probably benign 0.00
R5152:Col12a1 UTSW 9 79656748 missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79700262 missense probably benign 0.00
R5268:Col12a1 UTSW 9 79678047 missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79620060 missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79614363 missense probably benign 0.07
R5496:Col12a1 UTSW 9 79602185 splice site probably benign
R5537:Col12a1 UTSW 9 79699590 missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79703759 missense probably damaging 1.00
R5677:Col12a1 UTSW 9 79699321 missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79616065 nonsense probably null
R5796:Col12a1 UTSW 9 79703829 missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79633673 missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79604478 missense probably benign 0.00
R5919:Col12a1 UTSW 9 79602298 missense probably damaging 0.99
R5974:Col12a1 UTSW 9 79682127 missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79678506 missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79630560 missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79656578 critical splice donor site probably null
R6090:Col12a1 UTSW 9 79692393 missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79614358 missense probably benign 0.00
R6393:Col12a1 UTSW 9 79655485 missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79645691 missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79647605 missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79649949 missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79620049 missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79699605 missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79633424 missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79706337 missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79677234 missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79639809 missense possibly damaging 0.92
R6935:Col12a1 UTSW 9 79700500 missense possibly damaging 0.76
R7198:Col12a1 UTSW 9 79650032 missense possibly damaging 0.56
R7296:Col12a1 UTSW 9 79682066 missense probably damaging 1.00
R7365:Col12a1 UTSW 9 79706360 missense probably damaging 0.99
R7466:Col12a1 UTSW 9 79655407 missense possibly damaging 0.95
R7516:Col12a1 UTSW 9 79612910 splice site probably null
R7584:Col12a1 UTSW 9 79703296 critical splice donor site probably null
R7624:Col12a1 UTSW 9 79645794 splice site probably null
R7678:Col12a1 UTSW 9 79651486 missense probably damaging 0.99
R7702:Col12a1 UTSW 9 79681521 missense probably damaging 1.00
R7796:Col12a1 UTSW 9 79678551 missense possibly damaging 0.88
R7902:Col12a1 UTSW 9 79641581 missense probably benign 0.00
R7923:Col12a1 UTSW 9 79678493 missense probably benign 0.00
R7986:Col12a1 UTSW 9 79604392 critical splice donor site probably null
R8004:Col12a1 UTSW 9 79684401 missense probably damaging 1.00
R8046:Col12a1 UTSW 9 79706226 critical splice donor site probably null
R8056:Col12a1 UTSW 9 79599938 missense
R8151:Col12a1 UTSW 9 79630549 missense possibly damaging 0.62
R8203:Col12a1 UTSW 9 79681549 missense possibly damaging 0.94
R8221:Col12a1 UTSW 9 79643942 missense probably damaging 1.00
R8294:Col12a1 UTSW 9 79699312 missense possibly damaging 0.91
R8309:Col12a1 UTSW 9 79605183 missense possibly damaging 0.68
R8319:Col12a1 UTSW 9 79648697 missense probably damaging 0.97
X0021:Col12a1 UTSW 9 79608485 missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79602224 missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79612392 splice site probably null
Z1177:Col12a1 UTSW 9 79599986 missense possibly damaging 0.80
Z1177:Col12a1 UTSW 9 79639696 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATTTCTCAATGAGGCCGTG -3'
(R):5'- TGGGATGACACTCTTGGCTTATATTC -3'

Sequencing Primer
(F):5'- CGTGGCTCTGGGCTGAG -3'
(R):5'- GAGAACACATTCTTCTCTTAGAGGAG -3'
Posted On2019-11-12