Incidental Mutation 'R7670:Reep6'
ID 592102
Institutional Source Beutler Lab
Gene Symbol Reep6
Ensembl Gene ENSMUSG00000035504
Gene Name receptor accessory protein 6
Synonyms Dp1l1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7670 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 80329953-80336441 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80333793 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 105 (L105P)
Ref Sequence ENSEMBL: ENSMUSP00000100991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020340] [ENSMUST00000040081] [ENSMUST00000105354] [ENSMUST00000105355] [ENSMUST00000105357] [ENSMUST00000105358] [ENSMUST00000128653] [ENSMUST00000135071] [ENSMUST00000186864]
AlphaFold Q9JM62
Predicted Effect probably benign
Transcript: ENSMUST00000020340
SMART Domains Protein: ENSMUSP00000020340
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 1.2e-24 PFAM
Pfam:Peptidase_S8 146 429 3.1e-50 PFAM
Pfam:P_proprotein 488 574 5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040081
AA Change: L105P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043722
Gene: ENSMUSG00000035504
AA Change: L105P

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 50 118 8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105354
AA Change: L105P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100991
Gene: ENSMUSG00000035504
AA Change: L105P

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 50 144 5e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105355
AA Change: L105P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100992
Gene: ENSMUSG00000035504
AA Change: L105P

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 50 144 3.4e-36 PFAM
Predicted Effect silent
Transcript: ENSMUST00000105357
SMART Domains Protein: ENSMUSP00000100994
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
low complexity region 22 61 N/A INTRINSIC
low complexity region 108 129 N/A INTRINSIC
low complexity region 297 319 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
low complexity region 411 428 N/A INTRINSIC
SCOP:d1gkub1 434 465 1e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000105358
SMART Domains Protein: ENSMUSP00000100995
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
low complexity region 22 61 N/A INTRINSIC
low complexity region 108 129 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
SCOP:d1gkub1 461 492 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128653
SMART Domains Protein: ENSMUSP00000137809
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SCOP:d1kn6a_ 31 102 8e-29 SMART
Pfam:Peptidase_S8 150 242 6.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135071
SMART Domains Protein: ENSMUSP00000137719
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
SCOP:d1kn6a_ 14 85 3e-27 SMART
Pfam:Peptidase_S8 133 187 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186864
AA Change: L105P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140840
Gene: ENSMUSG00000035504
AA Change: L105P

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 50 144 5e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Adam26a T A 8: 43,570,153 H100L probably benign Het
Adgrf2 T C 17: 42,711,372 N187S probably damaging Het
Adipoq T A 16: 23,157,582 H244Q probably damaging Het
Arhgap40 T A 2: 158,531,925 S209T probably benign Het
Arrdc3 C T 13: 80,889,093 L123F probably damaging Het
Aspscr1 A G 11: 120,689,039 N212D probably benign Het
Ccr9 A T 9: 123,779,306 S18C probably damaging Het
Cdc42bpa T A 1: 180,065,081 V270D probably damaging Het
Clic4 A G 4: 135,217,205 Y220H probably damaging Het
Cntln A C 4: 84,979,340 H388P possibly damaging Het
Col12a1 A G 9: 79,631,643 V2457A probably damaging Het
Ctsk A G 3: 95,501,614 N103D probably benign Het
Ddx60 T C 8: 61,975,792 S779P probably damaging Het
Dnah5 T A 15: 28,246,232 probably null Het
Dnah7b T A 1: 46,109,302 D279E probably benign Het
Fam117a A G 11: 95,378,834 N308S probably benign Het
Fasn A G 11: 120,813,419 V1419A probably damaging Het
Fhad1 A G 4: 141,951,491 S625P probably benign Het
Gemin5 A G 11: 58,147,928 V585A probably benign Het
Gm5145 C A 17: 20,570,384 P8Q probably benign Het
Gm8332 T C 12: 88,249,754 N116S probably benign Het
Herc1 C A 9: 66,416,347 T1381K probably damaging Het
Herc6 T C 6: 57,660,122 I824T probably damaging Het
Klrb1 C T 6: 128,710,087 V161I probably benign Het
Krtap31-1 A G 11: 99,908,432 N154D not run Het
Lcp1 A T 14: 75,200,431 I94F probably benign Het
Lin7a A T 10: 107,382,691 Q154L possibly damaging Het
Lnx1 T C 5: 74,685,690 Y33C probably damaging Het
Myo5b T C 18: 74,701,446 V859A probably benign Het
Ncbp1 A G 4: 46,170,015 Q696R probably damaging Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nme8 T C 13: 19,658,829 E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,111,974 probably null Het
Nuggc A G 14: 65,613,526 I298V probably damaging Het
Nup155 A C 15: 8,153,696 K1247Q probably damaging Het
Olfr368 A T 2: 37,331,759 E4V probably benign Het
Olfr403 A G 11: 74,196,207 K235E probably damaging Het
Otud4 T A 8: 79,655,864 probably null Het
Pcdhb18 T C 18: 37,491,696 V693A probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Prkca A T 11: 108,014,344 N189K probably damaging Het
Rbm24 A G 13: 46,429,207 I201V probably benign Het
Retreg1 T C 15: 25,941,040 probably benign Het
Rev3l C T 10: 39,836,722 T2382I probably benign Het
Rnf31 A G 14: 55,594,361 N230S probably benign Het
Rreb1 T C 13: 37,931,572 L969P probably benign Het
Rsph4a T A 10: 33,909,033 N313K probably damaging Het
Serpina3f T A 12: 104,217,266 L129Q probably damaging Het
Slc9a2 T A 1: 40,718,997 V232D probably damaging Het
Stmn2 T C 3: 8,554,865 L121P probably damaging Het
Svep1 C T 4: 58,097,424 G1373D probably damaging Het
Tmem206 A G 1: 191,340,868 N162S probably benign Het
Tns1 C A 1: 73,952,477 R1014L possibly damaging Het
Top2b T C 14: 16,416,620 S1127P possibly damaging Het
Txndc16 A T 14: 45,135,867 C768* probably null Het
Ubl7 A T 9: 57,929,769 E354D probably benign Het
Ush2a T C 1: 188,784,708 L3205P possibly damaging Het
Xirp2 A G 2: 67,510,573 T1053A possibly damaging Het
Zbtb21 A G 16: 97,951,877 L402P probably damaging Het
Zfp27 T A 7: 29,894,796 K581N possibly damaging Het
Zfp62 A T 11: 49,215,076 probably benign Het
Other mutations in Reep6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1102:Reep6 UTSW 10 80335246 missense probably benign 0.02
R1711:Reep6 UTSW 10 80333981 missense possibly damaging 0.94
R1726:Reep6 UTSW 10 80335120 missense probably benign 0.01
R2054:Reep6 UTSW 10 80330322 nonsense probably null
R3838:Reep6 UTSW 10 80335889 missense probably damaging 0.96
R3883:Reep6 UTSW 10 80335535 missense probably benign 0.05
R4080:Reep6 UTSW 10 80330162 utr 5 prime probably benign
R4184:Reep6 UTSW 10 80333814 missense probably damaging 1.00
R4966:Reep6 UTSW 10 80333799 missense probably benign 0.01
R5087:Reep6 UTSW 10 80335175 missense probably damaging 0.98
R7027:Reep6 UTSW 10 80333965 critical splice acceptor site probably null
R7541:Reep6 UTSW 10 80335199 missense possibly damaging 0.49
R9416:Reep6 UTSW 10 80330257 missense probably benign 0.01
R9694:Reep6 UTSW 10 80333559 missense probably damaging 1.00
Z1177:Reep6 UTSW 10 80334134 missense probably null 0.98
Predicted Primers PCR Primer
(F):5'- ATCGGATTTGTATACCCCGC -3'
(R):5'- GCGCACTGTGTAGGGAAATTG -3'

Sequencing Primer
(F):5'- ATCGGATTTGTATACCCCGCATATG -3'
(R):5'- GGAAATTGAGCTGTGACTCAC -3'
Posted On 2019-11-12