Incidental Mutation 'R7670:Nuggc'
ID 592121
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Name nuclear GTPase, germinal center associated
Synonyms SLIP-GC, Gm600, LOC239151
MMRRC Submission 045742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7670 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 65835995-65885980 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65850975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 298 (I298V)
Ref Sequence ENSEMBL: ENSMUSP00000078434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
AlphaFold D3YWJ0
Predicted Effect probably damaging
Transcript: ENSMUST00000079469
AA Change: I298V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: I298V

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150897
AA Change: I282V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: I282V

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 44,023,190 (GRCm39) H100L probably benign Het
Adgrf2 T C 17: 43,022,263 (GRCm39) N187S probably damaging Het
Adipoq T A 16: 22,976,332 (GRCm39) H244Q probably damaging Het
Arhgap40 T A 2: 158,373,845 (GRCm39) S209T probably benign Het
Arrdc3 C T 13: 81,037,212 (GRCm39) L123F probably damaging Het
Aspscr1 A G 11: 120,579,865 (GRCm39) N212D probably benign Het
Ccr9 A T 9: 123,608,371 (GRCm39) S18C probably damaging Het
Cdc42bpa T A 1: 179,892,646 (GRCm39) V270D probably damaging Het
Clic4 A G 4: 134,944,516 (GRCm39) Y220H probably damaging Het
Cntln A C 4: 84,897,577 (GRCm39) H388P possibly damaging Het
Col12a1 A G 9: 79,538,925 (GRCm39) V2457A probably damaging Het
Ctsk A G 3: 95,408,925 (GRCm39) N103D probably benign Het
Ddx60 T C 8: 62,428,826 (GRCm39) S779P probably damaging Het
Dnah5 T A 15: 28,246,378 (GRCm39) probably null Het
Dnah7b T A 1: 46,148,462 (GRCm39) D279E probably benign Het
Eif1ad10 T C 12: 88,216,524 (GRCm39) N116S probably benign Het
Fam117a A G 11: 95,269,660 (GRCm39) N308S probably benign Het
Fasn A G 11: 120,704,245 (GRCm39) V1419A probably damaging Het
Fhad1 A G 4: 141,678,802 (GRCm39) S625P probably benign Het
Gemin5 A G 11: 58,038,754 (GRCm39) V585A probably benign Het
Gm5145 C A 17: 20,790,646 (GRCm39) P8Q probably benign Het
Herc1 C A 9: 66,323,629 (GRCm39) T1381K probably damaging Het
Herc6 T C 6: 57,637,107 (GRCm39) I824T probably damaging Het
Klrb1 C T 6: 128,687,050 (GRCm39) V161I probably benign Het
Krtap31-1 A G 11: 99,799,258 (GRCm39) N154D not run Het
Lcp1 A T 14: 75,437,871 (GRCm39) I94F probably benign Het
Lin7a A T 10: 107,218,552 (GRCm39) Q154L possibly damaging Het
Lnx1 T C 5: 74,846,351 (GRCm39) Y33C probably damaging Het
Myo5b T C 18: 74,834,517 (GRCm39) V859A probably benign Het
Ncbp1 A G 4: 46,170,015 (GRCm39) Q696R probably damaging Het
Neurl1b C G 17: 26,657,720 (GRCm39) H219Q probably benign Het
Nme8 T C 13: 19,842,999 (GRCm39) E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,349,414 (GRCm39) probably null Het
Nup155 A C 15: 8,183,180 (GRCm39) K1247Q probably damaging Het
Or1a1 A G 11: 74,087,033 (GRCm39) K235E probably damaging Het
Or5c1 A T 2: 37,221,771 (GRCm39) E4V probably benign Het
Otud4 T A 8: 80,382,493 (GRCm39) probably null Het
Pacc1 A G 1: 191,073,065 (GRCm39) N162S probably benign Het
Pcdhb18 T C 18: 37,624,749 (GRCm39) V693A probably damaging Het
Pcnx3 A G 19: 5,727,210 (GRCm39) F1108L probably benign Het
Prkca A T 11: 107,905,170 (GRCm39) N189K probably damaging Het
Rbm24 A G 13: 46,582,683 (GRCm39) I201V probably benign Het
Reep6 T C 10: 80,169,627 (GRCm39) L105P probably damaging Het
Retreg1 T C 15: 25,941,126 (GRCm39) probably benign Het
Rev3l C T 10: 39,712,718 (GRCm39) T2382I probably benign Het
Rnf31 A G 14: 55,831,818 (GRCm39) N230S probably benign Het
Rreb1 T C 13: 38,115,548 (GRCm39) L969P probably benign Het
Rsph4a T A 10: 33,785,029 (GRCm39) N313K probably damaging Het
Serpina3f T A 12: 104,183,525 (GRCm39) L129Q probably damaging Het
Slc9a2 T A 1: 40,758,157 (GRCm39) V232D probably damaging Het
Stmn2 T C 3: 8,619,925 (GRCm39) L121P probably damaging Het
Svep1 C T 4: 58,097,424 (GRCm39) G1373D probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Tns1 C A 1: 73,991,636 (GRCm39) R1014L possibly damaging Het
Top2b T C 14: 16,416,620 (GRCm38) S1127P possibly damaging Het
Txndc16 A T 14: 45,373,324 (GRCm39) C768* probably null Het
Ubl7 A T 9: 57,837,052 (GRCm39) E354D probably benign Het
Ush2a T C 1: 188,516,905 (GRCm39) L3205P possibly damaging Het
Xirp2 A G 2: 67,340,917 (GRCm39) T1053A possibly damaging Het
Zbtb21 A G 16: 97,753,077 (GRCm39) L402P probably damaging Het
Zfp27 T A 7: 29,594,221 (GRCm39) K581N possibly damaging Het
Zfp62 A T 11: 49,105,903 (GRCm39) probably benign Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65,860,656 (GRCm39) missense probably damaging 1.00
IGL01403:Nuggc APN 14 65,860,635 (GRCm39) missense probably benign 0.01
IGL01413:Nuggc APN 14 65,876,030 (GRCm39) missense probably benign 0.23
IGL02588:Nuggc APN 14 65,855,226 (GRCm39) splice site probably benign
R0102:Nuggc UTSW 14 65,851,000 (GRCm39) missense probably null 1.00
R0102:Nuggc UTSW 14 65,851,000 (GRCm39) missense probably null 1.00
R0395:Nuggc UTSW 14 65,850,921 (GRCm39) nonsense probably null
R0827:Nuggc UTSW 14 65,846,340 (GRCm39) missense probably damaging 1.00
R1496:Nuggc UTSW 14 65,861,582 (GRCm39) missense probably damaging 0.96
R1861:Nuggc UTSW 14 65,879,450 (GRCm39) splice site probably benign
R1986:Nuggc UTSW 14 65,879,370 (GRCm39) missense probably damaging 0.98
R1995:Nuggc UTSW 14 65,848,623 (GRCm39) missense probably benign 0.02
R2283:Nuggc UTSW 14 65,876,061 (GRCm39) missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65,861,591 (GRCm39) missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65,857,087 (GRCm39) missense probably benign 0.00
R3980:Nuggc UTSW 14 65,856,542 (GRCm39) critical splice donor site probably null
R4303:Nuggc UTSW 14 65,848,621 (GRCm39) missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65,848,659 (GRCm39) missense probably benign 0.19
R4734:Nuggc UTSW 14 65,860,679 (GRCm39) missense probably damaging 1.00
R5095:Nuggc UTSW 14 65,872,539 (GRCm39) nonsense probably null
R5108:Nuggc UTSW 14 65,876,129 (GRCm39) missense probably damaging 0.99
R5360:Nuggc UTSW 14 65,876,075 (GRCm39) missense probably damaging 1.00
R5547:Nuggc UTSW 14 65,879,330 (GRCm39) missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65,885,637 (GRCm39) nonsense probably null
R6494:Nuggc UTSW 14 65,885,671 (GRCm39) missense probably damaging 1.00
R6922:Nuggc UTSW 14 65,855,092 (GRCm39) missense probably damaging 1.00
R6971:Nuggc UTSW 14 65,846,305 (GRCm39) missense probably benign 0.04
R7124:Nuggc UTSW 14 65,846,251 (GRCm39) missense probably damaging 1.00
R7273:Nuggc UTSW 14 65,857,057 (GRCm39) missense probably damaging 0.99
R7282:Nuggc UTSW 14 65,855,072 (GRCm39) missense probably damaging 1.00
R7578:Nuggc UTSW 14 65,885,623 (GRCm39) missense probably damaging 1.00
R7780:Nuggc UTSW 14 65,882,490 (GRCm39) missense probably damaging 1.00
R7871:Nuggc UTSW 14 65,860,700 (GRCm39) missense probably benign 0.01
R8250:Nuggc UTSW 14 65,879,318 (GRCm39) missense probably benign 0.10
R8329:Nuggc UTSW 14 65,878,731 (GRCm39) missense probably benign 0.01
R8334:Nuggc UTSW 14 65,882,478 (GRCm39) missense probably benign 0.04
R8463:Nuggc UTSW 14 65,851,011 (GRCm39) missense probably damaging 1.00
R8503:Nuggc UTSW 14 65,878,797 (GRCm39) critical splice donor site probably null
R8737:Nuggc UTSW 14 65,882,535 (GRCm39) missense probably benign 0.00
R8861:Nuggc UTSW 14 65,847,484 (GRCm39) critical splice donor site probably null
R8914:Nuggc UTSW 14 65,879,354 (GRCm39) missense probably benign
R9573:Nuggc UTSW 14 65,848,603 (GRCm39) missense probably benign 0.37
R9666:Nuggc UTSW 14 65,857,045 (GRCm39) missense possibly damaging 0.86
R9792:Nuggc UTSW 14 65,847,345 (GRCm39) missense probably damaging 1.00
R9793:Nuggc UTSW 14 65,847,345 (GRCm39) missense probably damaging 1.00
R9795:Nuggc UTSW 14 65,847,345 (GRCm39) missense probably damaging 1.00
RF019:Nuggc UTSW 14 65,885,713 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCAGGATAAAGAGCTGTC -3'
(R):5'- TGCCCTGTTTAACACCTGAACAC -3'

Sequencing Primer
(F):5'- GTCAGCATGATTGGTATGTACAACC -3'
(R):5'- TTAACACCTGAACACAGAATATGAGG -3'
Posted On 2019-11-12