Incidental Mutation 'R7670:Adipoq'
ID 592128
Institutional Source Beutler Lab
Gene Symbol Adipoq
Ensembl Gene ENSMUSG00000022878
Gene Name adiponectin, C1Q and collagen domain containing
Synonyms Acdc, adiponectin, GBP28, APN, adipo, Acrp30, apM1
MMRRC Submission 045742-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R7670 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 23146536-23158028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23157582 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 244 (H244Q)
Ref Sequence ENSEMBL: ENSMUSP00000023593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023593] [ENSMUST00000171309]
AlphaFold Q60994
PDB Structure THE CRYSTAL STRUCTURE OF A COMPLMENT-1Q FAMILY PROTEIN SUGGESTS AN EVOLUTIONARY LINK TO TUMOR NECROSIS FACTOR [X-RAY DIFFRACTION]
ACRP30 CALCIUM COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023593
AA Change: H244Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023593
Gene: ENSMUSG00000022878
AA Change: H244Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
internal_repeat_1 45 74 2.54e-5 PROSPERO
C1Q 109 245 2.81e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171309
SMART Domains Protein: ENSMUSP00000126793
Gene: ENSMUSG00000022878

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Collagen 61 133 1.4e-11 PFAM
SCOP:d1gr3a_ 134 168 2e-11 SMART
Meta Mutation Damage Score 0.0901 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in adipose tissue exclusively. It encodes a protein with similarity to collagens X and VIII and complement factor C1q. The encoded protein circulates in the plasma and is involved with metabolic and hormonal processes. Mutations in this gene are associated with adiponectin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased beta-oxidation in muscle and liver, impaired free fatty acid clearance, and moderate insulin resistance. Heterozygotes show mild insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Adam26a T A 8: 43,570,153 H100L probably benign Het
Adgrf2 T C 17: 42,711,372 N187S probably damaging Het
Arhgap40 T A 2: 158,531,925 S209T probably benign Het
Arrdc3 C T 13: 80,889,093 L123F probably damaging Het
Aspscr1 A G 11: 120,689,039 N212D probably benign Het
Ccr9 A T 9: 123,779,306 S18C probably damaging Het
Cdc42bpa T A 1: 180,065,081 V270D probably damaging Het
Clic4 A G 4: 135,217,205 Y220H probably damaging Het
Cntln A C 4: 84,979,340 H388P possibly damaging Het
Col12a1 A G 9: 79,631,643 V2457A probably damaging Het
Ctsk A G 3: 95,501,614 N103D probably benign Het
Ddx60 T C 8: 61,975,792 S779P probably damaging Het
Dnah5 T A 15: 28,246,232 probably null Het
Dnah7b T A 1: 46,109,302 D279E probably benign Het
Fam117a A G 11: 95,378,834 N308S probably benign Het
Fasn A G 11: 120,813,419 V1419A probably damaging Het
Fhad1 A G 4: 141,951,491 S625P probably benign Het
Gemin5 A G 11: 58,147,928 V585A probably benign Het
Gm5145 C A 17: 20,570,384 P8Q probably benign Het
Gm8332 T C 12: 88,249,754 N116S probably benign Het
Herc1 C A 9: 66,416,347 T1381K probably damaging Het
Herc6 T C 6: 57,660,122 I824T probably damaging Het
Klrb1 C T 6: 128,710,087 V161I probably benign Het
Krtap31-1 A G 11: 99,908,432 N154D not run Het
Lcp1 A T 14: 75,200,431 I94F probably benign Het
Lin7a A T 10: 107,382,691 Q154L possibly damaging Het
Lnx1 T C 5: 74,685,690 Y33C probably damaging Het
Myo5b T C 18: 74,701,446 V859A probably benign Het
Ncbp1 A G 4: 46,170,015 Q696R probably damaging Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nme8 T C 13: 19,658,829 E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,111,974 probably null Het
Nuggc A G 14: 65,613,526 I298V probably damaging Het
Nup155 A C 15: 8,153,696 K1247Q probably damaging Het
Olfr368 A T 2: 37,331,759 E4V probably benign Het
Olfr403 A G 11: 74,196,207 K235E probably damaging Het
Otud4 T A 8: 79,655,864 probably null Het
Pcdhb18 T C 18: 37,491,696 V693A probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Prkca A T 11: 108,014,344 N189K probably damaging Het
Rbm24 A G 13: 46,429,207 I201V probably benign Het
Reep6 T C 10: 80,333,793 L105P probably damaging Het
Retreg1 T C 15: 25,941,040 probably benign Het
Rev3l C T 10: 39,836,722 T2382I probably benign Het
Rnf31 A G 14: 55,594,361 N230S probably benign Het
Rreb1 T C 13: 37,931,572 L969P probably benign Het
Rsph4a T A 10: 33,909,033 N313K probably damaging Het
Serpina3f T A 12: 104,217,266 L129Q probably damaging Het
Slc9a2 T A 1: 40,718,997 V232D probably damaging Het
Stmn2 T C 3: 8,554,865 L121P probably damaging Het
Svep1 C T 4: 58,097,424 G1373D probably damaging Het
Tmem206 A G 1: 191,340,868 N162S probably benign Het
Tns1 C A 1: 73,952,477 R1014L possibly damaging Het
Top2b T C 14: 16,416,620 S1127P possibly damaging Het
Txndc16 A T 14: 45,135,867 C768* probably null Het
Ubl7 A T 9: 57,929,769 E354D probably benign Het
Ush2a T C 1: 188,784,708 L3205P possibly damaging Het
Xirp2 A G 2: 67,510,573 T1053A possibly damaging Het
Zbtb21 A G 16: 97,951,877 L402P probably damaging Het
Zfp27 T A 7: 29,894,796 K581N possibly damaging Het
Zfp62 A T 11: 49,215,076 probably benign Het
Other mutations in Adipoq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Adipoq APN 16 23157115 missense possibly damaging 0.64
R0196:Adipoq UTSW 16 23146643 splice site probably null
R0617:Adipoq UTSW 16 23155410 missense probably damaging 1.00
R1773:Adipoq UTSW 16 23155238 missense unknown
R2284:Adipoq UTSW 16 23157487 nonsense probably null
R2367:Adipoq UTSW 16 23155319 missense probably benign 0.05
R3767:Adipoq UTSW 16 23157188 missense possibly damaging 0.83
R8557:Adipoq UTSW 16 23146680 intron probably benign
R9434:Adipoq UTSW 16 23146947 intron probably benign
X0026:Adipoq UTSW 16 23155284 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCACCTACGACCAGTATCAGG -3'
(R):5'- TGCTACCATGTAAGAGTCGTGG -3'

Sequencing Primer
(F):5'- GAAAAGAATGTGGACCAGGCCTC -3'
(R):5'- TGGAGACCAGGGAGTGCC -3'
Posted On 2019-11-12