Incidental Mutation 'R7670:Neurl1b'
ID 592132
Institutional Source Beutler Lab
Gene Symbol Neurl1b
Ensembl Gene ENSMUSG00000034413
Gene Name neuralized E3 ubiquitin protein ligase 1B
Synonyms EG240055, Neur2, C230078M08Rik
MMRRC Submission 045742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R7670 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 26633833-26665295 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 26657720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 219 (H219Q)
Ref Sequence ENSEMBL: ENSMUSP00000051481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053020] [ENSMUST00000182897] [ENSMUST00000183077]
AlphaFold Q0MW30
Predicted Effect probably benign
Transcript: ENSMUST00000053020
AA Change: H219Q

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051481
Gene: ENSMUSG00000034413
AA Change: H219Q

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 192 1e-12 BLAST
Blast:NEUZ 219 245 1e-8 BLAST
NEUZ 268 390 7.66e-24 SMART
low complexity region 436 449 N/A INTRINSIC
low complexity region 457 486 N/A INTRINSIC
RING 494 533 2.38e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182897
AA Change: H37Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138417
Gene: ENSMUSG00000034413
AA Change: H37Q

DomainStartEndE-ValueType
Blast:NEUZ 37 63 5e-9 BLAST
Pfam:Neuralized 88 156 2.8e-14 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 304 N/A INTRINSIC
RING 312 351 2.38e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183077
SMART Domains Protein: ENSMUSP00000138178
Gene: ENSMUSG00000034413

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 225 2e-14 BLAST
low complexity region 226 255 N/A INTRINSIC
RING 263 302 2.38e-2 SMART
Meta Mutation Damage Score 0.0651 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 44,023,190 (GRCm39) H100L probably benign Het
Adgrf2 T C 17: 43,022,263 (GRCm39) N187S probably damaging Het
Adipoq T A 16: 22,976,332 (GRCm39) H244Q probably damaging Het
Arhgap40 T A 2: 158,373,845 (GRCm39) S209T probably benign Het
Arrdc3 C T 13: 81,037,212 (GRCm39) L123F probably damaging Het
Aspscr1 A G 11: 120,579,865 (GRCm39) N212D probably benign Het
Ccr9 A T 9: 123,608,371 (GRCm39) S18C probably damaging Het
Cdc42bpa T A 1: 179,892,646 (GRCm39) V270D probably damaging Het
Clic4 A G 4: 134,944,516 (GRCm39) Y220H probably damaging Het
Cntln A C 4: 84,897,577 (GRCm39) H388P possibly damaging Het
Col12a1 A G 9: 79,538,925 (GRCm39) V2457A probably damaging Het
Ctsk A G 3: 95,408,925 (GRCm39) N103D probably benign Het
Ddx60 T C 8: 62,428,826 (GRCm39) S779P probably damaging Het
Dnah5 T A 15: 28,246,378 (GRCm39) probably null Het
Dnah7b T A 1: 46,148,462 (GRCm39) D279E probably benign Het
Eif1ad10 T C 12: 88,216,524 (GRCm39) N116S probably benign Het
Fam117a A G 11: 95,269,660 (GRCm39) N308S probably benign Het
Fasn A G 11: 120,704,245 (GRCm39) V1419A probably damaging Het
Fhad1 A G 4: 141,678,802 (GRCm39) S625P probably benign Het
Gemin5 A G 11: 58,038,754 (GRCm39) V585A probably benign Het
Gm5145 C A 17: 20,790,646 (GRCm39) P8Q probably benign Het
Herc1 C A 9: 66,323,629 (GRCm39) T1381K probably damaging Het
Herc6 T C 6: 57,637,107 (GRCm39) I824T probably damaging Het
Klrb1 C T 6: 128,687,050 (GRCm39) V161I probably benign Het
Krtap31-1 A G 11: 99,799,258 (GRCm39) N154D not run Het
Lcp1 A T 14: 75,437,871 (GRCm39) I94F probably benign Het
Lin7a A T 10: 107,218,552 (GRCm39) Q154L possibly damaging Het
Lnx1 T C 5: 74,846,351 (GRCm39) Y33C probably damaging Het
Myo5b T C 18: 74,834,517 (GRCm39) V859A probably benign Het
Ncbp1 A G 4: 46,170,015 (GRCm39) Q696R probably damaging Het
Nme8 T C 13: 19,842,999 (GRCm39) E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,349,414 (GRCm39) probably null Het
Nuggc A G 14: 65,850,975 (GRCm39) I298V probably damaging Het
Nup155 A C 15: 8,183,180 (GRCm39) K1247Q probably damaging Het
Or1a1 A G 11: 74,087,033 (GRCm39) K235E probably damaging Het
Or5c1 A T 2: 37,221,771 (GRCm39) E4V probably benign Het
Otud4 T A 8: 80,382,493 (GRCm39) probably null Het
Pacc1 A G 1: 191,073,065 (GRCm39) N162S probably benign Het
Pcdhb18 T C 18: 37,624,749 (GRCm39) V693A probably damaging Het
Pcnx3 A G 19: 5,727,210 (GRCm39) F1108L probably benign Het
Prkca A T 11: 107,905,170 (GRCm39) N189K probably damaging Het
Rbm24 A G 13: 46,582,683 (GRCm39) I201V probably benign Het
Reep6 T C 10: 80,169,627 (GRCm39) L105P probably damaging Het
Retreg1 T C 15: 25,941,126 (GRCm39) probably benign Het
Rev3l C T 10: 39,712,718 (GRCm39) T2382I probably benign Het
Rnf31 A G 14: 55,831,818 (GRCm39) N230S probably benign Het
Rreb1 T C 13: 38,115,548 (GRCm39) L969P probably benign Het
Rsph4a T A 10: 33,785,029 (GRCm39) N313K probably damaging Het
Serpina3f T A 12: 104,183,525 (GRCm39) L129Q probably damaging Het
Slc9a2 T A 1: 40,758,157 (GRCm39) V232D probably damaging Het
Stmn2 T C 3: 8,619,925 (GRCm39) L121P probably damaging Het
Svep1 C T 4: 58,097,424 (GRCm39) G1373D probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Tns1 C A 1: 73,991,636 (GRCm39) R1014L possibly damaging Het
Top2b T C 14: 16,416,620 (GRCm38) S1127P possibly damaging Het
Txndc16 A T 14: 45,373,324 (GRCm39) C768* probably null Het
Ubl7 A T 9: 57,837,052 (GRCm39) E354D probably benign Het
Ush2a T C 1: 188,516,905 (GRCm39) L3205P possibly damaging Het
Xirp2 A G 2: 67,340,917 (GRCm39) T1053A possibly damaging Het
Zbtb21 A G 16: 97,753,077 (GRCm39) L402P probably damaging Het
Zfp27 T A 7: 29,594,221 (GRCm39) K581N possibly damaging Het
Zfp62 A T 11: 49,105,903 (GRCm39) probably benign Het
Other mutations in Neurl1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Neurl1b APN 17 26,651,152 (GRCm39) missense probably damaging 0.99
R0530:Neurl1b UTSW 17 26,660,519 (GRCm39) splice site probably null
R1819:Neurl1b UTSW 17 26,657,674 (GRCm39) missense probably benign 0.01
R2359:Neurl1b UTSW 17 26,660,569 (GRCm39) missense probably benign 0.03
R3720:Neurl1b UTSW 17 26,633,949 (GRCm39) missense probably damaging 1.00
R4574:Neurl1b UTSW 17 26,650,860 (GRCm39) missense probably benign 0.19
R7508:Neurl1b UTSW 17 26,657,720 (GRCm39) missense probably benign 0.13
R7509:Neurl1b UTSW 17 26,657,720 (GRCm39) missense probably benign 0.13
R7642:Neurl1b UTSW 17 26,657,720 (GRCm39) missense probably benign 0.13
R7654:Neurl1b UTSW 17 26,657,671 (GRCm39) missense probably benign 0.00
R7669:Neurl1b UTSW 17 26,657,720 (GRCm39) missense probably benign 0.13
R7722:Neurl1b UTSW 17 26,660,132 (GRCm39) missense probably benign
R8069:Neurl1b UTSW 17 26,651,201 (GRCm39) missense probably damaging 1.00
R8343:Neurl1b UTSW 17 26,650,965 (GRCm39) missense probably damaging 1.00
R8711:Neurl1b UTSW 17 26,660,747 (GRCm39) missense probably damaging 1.00
R8770:Neurl1b UTSW 17 26,650,887 (GRCm39) missense probably damaging 1.00
R9176:Neurl1b UTSW 17 26,660,055 (GRCm39) missense possibly damaging 0.94
R9405:Neurl1b UTSW 17 26,658,265 (GRCm39) missense probably benign 0.19
R9406:Neurl1b UTSW 17 26,657,820 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGAGGTTGCAGGTCAGG -3'
(R):5'- AGTATTCCTTGCGGTCCAGC -3'

Sequencing Primer
(F):5'- TTGCAGGTCAGGGGCAACTG -3'
(R):5'- ATCGCAGGACGTGATGC -3'
Posted On 2019-11-12