Incidental Mutation 'R7670:Adgrf2'
ID 592133
Institutional Source Beutler Lab
Gene Symbol Adgrf2
Ensembl Gene ENSMUSG00000057899
Gene Name adhesion G protein-coupled receptor F2
Synonyms PGR20, Gpr111
MMRRC Submission 045742-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7670 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 43007021-43053070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43022263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 187 (N187S)
Ref Sequence ENSEMBL: ENSMUSP00000109244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113614]
AlphaFold E9Q4J9
Predicted Effect probably damaging
Transcript: ENSMUST00000113614
AA Change: N187S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109244
Gene: ENSMUSG00000057899
AA Change: N187S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 325 376 2.05e-4 SMART
Pfam:7tm_2 378 625 4.1e-29 PFAM
Meta Mutation Damage Score 0.3298 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 44,023,190 (GRCm39) H100L probably benign Het
Adipoq T A 16: 22,976,332 (GRCm39) H244Q probably damaging Het
Arhgap40 T A 2: 158,373,845 (GRCm39) S209T probably benign Het
Arrdc3 C T 13: 81,037,212 (GRCm39) L123F probably damaging Het
Aspscr1 A G 11: 120,579,865 (GRCm39) N212D probably benign Het
Ccr9 A T 9: 123,608,371 (GRCm39) S18C probably damaging Het
Cdc42bpa T A 1: 179,892,646 (GRCm39) V270D probably damaging Het
Clic4 A G 4: 134,944,516 (GRCm39) Y220H probably damaging Het
Cntln A C 4: 84,897,577 (GRCm39) H388P possibly damaging Het
Col12a1 A G 9: 79,538,925 (GRCm39) V2457A probably damaging Het
Ctsk A G 3: 95,408,925 (GRCm39) N103D probably benign Het
Ddx60 T C 8: 62,428,826 (GRCm39) S779P probably damaging Het
Dnah5 T A 15: 28,246,378 (GRCm39) probably null Het
Dnah7b T A 1: 46,148,462 (GRCm39) D279E probably benign Het
Eif1ad10 T C 12: 88,216,524 (GRCm39) N116S probably benign Het
Fam117a A G 11: 95,269,660 (GRCm39) N308S probably benign Het
Fasn A G 11: 120,704,245 (GRCm39) V1419A probably damaging Het
Fhad1 A G 4: 141,678,802 (GRCm39) S625P probably benign Het
Gemin5 A G 11: 58,038,754 (GRCm39) V585A probably benign Het
Gm5145 C A 17: 20,790,646 (GRCm39) P8Q probably benign Het
Herc1 C A 9: 66,323,629 (GRCm39) T1381K probably damaging Het
Herc6 T C 6: 57,637,107 (GRCm39) I824T probably damaging Het
Klrb1 C T 6: 128,687,050 (GRCm39) V161I probably benign Het
Krtap31-1 A G 11: 99,799,258 (GRCm39) N154D not run Het
Lcp1 A T 14: 75,437,871 (GRCm39) I94F probably benign Het
Lin7a A T 10: 107,218,552 (GRCm39) Q154L possibly damaging Het
Lnx1 T C 5: 74,846,351 (GRCm39) Y33C probably damaging Het
Myo5b T C 18: 74,834,517 (GRCm39) V859A probably benign Het
Ncbp1 A G 4: 46,170,015 (GRCm39) Q696R probably damaging Het
Neurl1b C G 17: 26,657,720 (GRCm39) H219Q probably benign Het
Nme8 T C 13: 19,842,999 (GRCm39) E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,349,414 (GRCm39) probably null Het
Nuggc A G 14: 65,850,975 (GRCm39) I298V probably damaging Het
Nup155 A C 15: 8,183,180 (GRCm39) K1247Q probably damaging Het
Or1a1 A G 11: 74,087,033 (GRCm39) K235E probably damaging Het
Or5c1 A T 2: 37,221,771 (GRCm39) E4V probably benign Het
Otud4 T A 8: 80,382,493 (GRCm39) probably null Het
Pacc1 A G 1: 191,073,065 (GRCm39) N162S probably benign Het
Pcdhb18 T C 18: 37,624,749 (GRCm39) V693A probably damaging Het
Pcnx3 A G 19: 5,727,210 (GRCm39) F1108L probably benign Het
Prkca A T 11: 107,905,170 (GRCm39) N189K probably damaging Het
Rbm24 A G 13: 46,582,683 (GRCm39) I201V probably benign Het
Reep6 T C 10: 80,169,627 (GRCm39) L105P probably damaging Het
Retreg1 T C 15: 25,941,126 (GRCm39) probably benign Het
Rev3l C T 10: 39,712,718 (GRCm39) T2382I probably benign Het
Rnf31 A G 14: 55,831,818 (GRCm39) N230S probably benign Het
Rreb1 T C 13: 38,115,548 (GRCm39) L969P probably benign Het
Rsph4a T A 10: 33,785,029 (GRCm39) N313K probably damaging Het
Serpina3f T A 12: 104,183,525 (GRCm39) L129Q probably damaging Het
Slc9a2 T A 1: 40,758,157 (GRCm39) V232D probably damaging Het
Stmn2 T C 3: 8,619,925 (GRCm39) L121P probably damaging Het
Svep1 C T 4: 58,097,424 (GRCm39) G1373D probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Tns1 C A 1: 73,991,636 (GRCm39) R1014L possibly damaging Het
Top2b T C 14: 16,416,620 (GRCm38) S1127P possibly damaging Het
Txndc16 A T 14: 45,373,324 (GRCm39) C768* probably null Het
Ubl7 A T 9: 57,837,052 (GRCm39) E354D probably benign Het
Ush2a T C 1: 188,516,905 (GRCm39) L3205P possibly damaging Het
Xirp2 A G 2: 67,340,917 (GRCm39) T1053A possibly damaging Het
Zbtb21 A G 16: 97,753,077 (GRCm39) L402P probably damaging Het
Zfp27 T A 7: 29,594,221 (GRCm39) K581N possibly damaging Het
Zfp62 A T 11: 49,105,903 (GRCm39) probably benign Het
Other mutations in Adgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adgrf2 APN 17 43,025,206 (GRCm39) splice site probably benign
IGL01089:Adgrf2 APN 17 43,021,049 (GRCm39) missense probably damaging 1.00
IGL01601:Adgrf2 APN 17 43,020,940 (GRCm39) missense probably benign
IGL01765:Adgrf2 APN 17 43,030,426 (GRCm39) missense probably benign 0.06
IGL02946:Adgrf2 APN 17 43,021,384 (GRCm39) missense probably damaging 1.00
R0498:Adgrf2 UTSW 17 43,025,206 (GRCm39) splice site probably benign
R0720:Adgrf2 UTSW 17 43,024,063 (GRCm39) missense probably damaging 1.00
R0831:Adgrf2 UTSW 17 43,021,334 (GRCm39) missense probably damaging 0.96
R1664:Adgrf2 UTSW 17 43,025,305 (GRCm39) missense possibly damaging 0.92
R2008:Adgrf2 UTSW 17 43,021,013 (GRCm39) missense probably damaging 0.96
R2306:Adgrf2 UTSW 17 43,024,010 (GRCm39) missense possibly damaging 0.92
R2519:Adgrf2 UTSW 17 43,021,298 (GRCm39) missense probably damaging 1.00
R3713:Adgrf2 UTSW 17 43,023,979 (GRCm39) missense probably damaging 1.00
R3736:Adgrf2 UTSW 17 43,021,903 (GRCm39) missense probably benign 0.32
R4272:Adgrf2 UTSW 17 43,021,013 (GRCm39) missense probably damaging 0.99
R4273:Adgrf2 UTSW 17 43,021,013 (GRCm39) missense probably damaging 0.99
R4422:Adgrf2 UTSW 17 43,024,046 (GRCm39) missense probably benign
R4732:Adgrf2 UTSW 17 43,021,645 (GRCm39) missense probably damaging 1.00
R4733:Adgrf2 UTSW 17 43,021,645 (GRCm39) missense probably damaging 1.00
R4906:Adgrf2 UTSW 17 43,022,084 (GRCm39) missense probably benign
R5053:Adgrf2 UTSW 17 43,021,334 (GRCm39) missense probably damaging 0.96
R5078:Adgrf2 UTSW 17 43,021,877 (GRCm39) missense probably damaging 1.00
R5089:Adgrf2 UTSW 17 43,020,988 (GRCm39) missense probably benign 0.00
R5147:Adgrf2 UTSW 17 43,021,574 (GRCm39) missense probably damaging 0.99
R5953:Adgrf2 UTSW 17 43,021,229 (GRCm39) missense probably damaging 1.00
R5968:Adgrf2 UTSW 17 43,026,063 (GRCm39) critical splice donor site probably null
R6791:Adgrf2 UTSW 17 43,021,774 (GRCm39) missense probably benign 0.02
R7138:Adgrf2 UTSW 17 43,021,874 (GRCm39) missense probably damaging 1.00
R7612:Adgrf2 UTSW 17 43,025,271 (GRCm39) missense possibly damaging 0.68
R8291:Adgrf2 UTSW 17 43,021,451 (GRCm39) missense probably damaging 1.00
R8418:Adgrf2 UTSW 17 43,021,477 (GRCm39) missense probably benign 0.01
R8510:Adgrf2 UTSW 17 43,030,431 (GRCm39) nonsense probably null
R9736:Adgrf2 UTSW 17 43,022,212 (GRCm39) missense probably benign 0.42
X0061:Adgrf2 UTSW 17 43,023,965 (GRCm39) missense probably benign 0.37
X0067:Adgrf2 UTSW 17 43,021,559 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGTGAAATTCTTCCCAAGGC -3'
(R):5'- AATATGTGATGCAGGCAGTTTG -3'

Sequencing Primer
(F):5'- GAAATTCTTCCCAAGGCTGCCC -3'
(R):5'- TTACTCTGCAAAGAAGTTACCCGGG -3'
Posted On 2019-11-12