Incidental Mutation 'R7670:Adgrf2'
ID 592133
Institutional Source Beutler Lab
Gene Symbol Adgrf2
Ensembl Gene ENSMUSG00000057899
Gene Name adhesion G protein-coupled receptor F2
Synonyms Gpr111, PGR20
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7670 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 42708936-42742179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42711372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 187 (N187S)
Ref Sequence ENSEMBL: ENSMUSP00000109244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113614]
AlphaFold E9Q4J9
Predicted Effect probably damaging
Transcript: ENSMUST00000113614
AA Change: N187S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109244
Gene: ENSMUSG00000057899
AA Change: N187S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 325 376 2.05e-4 SMART
Pfam:7tm_2 378 625 4.1e-29 PFAM
Meta Mutation Damage Score 0.3298 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Adam26a T A 8: 43,570,153 H100L probably benign Het
Adipoq T A 16: 23,157,582 H244Q probably damaging Het
Arhgap40 T A 2: 158,531,925 S209T probably benign Het
Arrdc3 C T 13: 80,889,093 L123F probably damaging Het
Aspscr1 A G 11: 120,689,039 N212D probably benign Het
Ccr9 A T 9: 123,779,306 S18C probably damaging Het
Cdc42bpa T A 1: 180,065,081 V270D probably damaging Het
Clic4 A G 4: 135,217,205 Y220H probably damaging Het
Cntln A C 4: 84,979,340 H388P possibly damaging Het
Col12a1 A G 9: 79,631,643 V2457A probably damaging Het
Ctsk A G 3: 95,501,614 N103D probably benign Het
Ddx60 T C 8: 61,975,792 S779P probably damaging Het
Dnah5 T A 15: 28,246,232 probably null Het
Dnah7b T A 1: 46,109,302 D279E probably benign Het
Fam117a A G 11: 95,378,834 N308S probably benign Het
Fasn A G 11: 120,813,419 V1419A probably damaging Het
Fhad1 A G 4: 141,951,491 S625P probably benign Het
Gemin5 A G 11: 58,147,928 V585A probably benign Het
Gm5145 C A 17: 20,570,384 P8Q probably benign Het
Gm8332 T C 12: 88,249,754 N116S probably benign Het
Herc1 C A 9: 66,416,347 T1381K probably damaging Het
Herc6 T C 6: 57,660,122 I824T probably damaging Het
Klrb1 C T 6: 128,710,087 V161I probably benign Het
Krtap31-1 A G 11: 99,908,432 N154D not run Het
Lcp1 A T 14: 75,200,431 I94F probably benign Het
Lin7a A T 10: 107,382,691 Q154L possibly damaging Het
Lnx1 T C 5: 74,685,690 Y33C probably damaging Het
Myo5b T C 18: 74,701,446 V859A probably benign Het
Ncbp1 A G 4: 46,170,015 Q696R probably damaging Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nme8 T C 13: 19,658,829 E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,111,974 probably null Het
Nuggc A G 14: 65,613,526 I298V probably damaging Het
Nup155 A C 15: 8,153,696 K1247Q probably damaging Het
Olfr368 A T 2: 37,331,759 E4V probably benign Het
Olfr403 A G 11: 74,196,207 K235E probably damaging Het
Otud4 T A 8: 79,655,864 probably null Het
Pcdhb18 T C 18: 37,491,696 V693A probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Prkca A T 11: 108,014,344 N189K probably damaging Het
Rbm24 A G 13: 46,429,207 I201V probably benign Het
Reep6 T C 10: 80,333,793 L105P probably damaging Het
Retreg1 T C 15: 25,941,040 probably benign Het
Rev3l C T 10: 39,836,722 T2382I probably benign Het
Rnf31 A G 14: 55,594,361 N230S probably benign Het
Rreb1 T C 13: 37,931,572 L969P probably benign Het
Rsph4a T A 10: 33,909,033 N313K probably damaging Het
Serpina3f T A 12: 104,217,266 L129Q probably damaging Het
Slc9a2 T A 1: 40,718,997 V232D probably damaging Het
Stmn2 T C 3: 8,554,865 L121P probably damaging Het
Svep1 C T 4: 58,097,424 G1373D probably damaging Het
Tmem206 A G 1: 191,340,868 N162S probably benign Het
Tns1 C A 1: 73,952,477 R1014L possibly damaging Het
Top2b T C 14: 16,416,620 S1127P possibly damaging Het
Txndc16 A T 14: 45,135,867 C768* probably null Het
Ubl7 A T 9: 57,929,769 E354D probably benign Het
Ush2a T C 1: 188,784,708 L3205P possibly damaging Het
Xirp2 A G 2: 67,510,573 T1053A possibly damaging Het
Zbtb21 A G 16: 97,951,877 L402P probably damaging Het
Zfp27 T A 7: 29,894,796 K581N possibly damaging Het
Zfp62 A T 11: 49,215,076 probably benign Het
Other mutations in Adgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adgrf2 APN 17 42714315 splice site probably benign
IGL01089:Adgrf2 APN 17 42710158 missense probably damaging 1.00
IGL01601:Adgrf2 APN 17 42710049 missense probably benign
IGL01765:Adgrf2 APN 17 42719535 missense probably benign 0.06
IGL02946:Adgrf2 APN 17 42710493 missense probably damaging 1.00
R0498:Adgrf2 UTSW 17 42714315 splice site probably benign
R0720:Adgrf2 UTSW 17 42713172 missense probably damaging 1.00
R0831:Adgrf2 UTSW 17 42710443 missense probably damaging 0.96
R1664:Adgrf2 UTSW 17 42714414 missense possibly damaging 0.92
R2008:Adgrf2 UTSW 17 42710122 missense probably damaging 0.96
R2306:Adgrf2 UTSW 17 42713119 missense possibly damaging 0.92
R2519:Adgrf2 UTSW 17 42710407 missense probably damaging 1.00
R3713:Adgrf2 UTSW 17 42713088 missense probably damaging 1.00
R3736:Adgrf2 UTSW 17 42711012 missense probably benign 0.32
R4272:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4273:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4422:Adgrf2 UTSW 17 42713155 missense probably benign
R4732:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4733:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4906:Adgrf2 UTSW 17 42711193 missense probably benign
R5053:Adgrf2 UTSW 17 42710443 missense probably damaging 0.96
R5078:Adgrf2 UTSW 17 42710986 missense probably damaging 1.00
R5089:Adgrf2 UTSW 17 42710097 missense probably benign 0.00
R5147:Adgrf2 UTSW 17 42710683 missense probably damaging 0.99
R5953:Adgrf2 UTSW 17 42710338 missense probably damaging 1.00
R5968:Adgrf2 UTSW 17 42715172 critical splice donor site probably null
R6791:Adgrf2 UTSW 17 42710883 missense probably benign 0.02
R7138:Adgrf2 UTSW 17 42710983 missense probably damaging 1.00
R7612:Adgrf2 UTSW 17 42714380 missense possibly damaging 0.68
R8291:Adgrf2 UTSW 17 42710560 missense probably damaging 1.00
R8418:Adgrf2 UTSW 17 42710586 missense probably benign 0.01
R8510:Adgrf2 UTSW 17 42719540 nonsense probably null
R9736:Adgrf2 UTSW 17 42711321 missense probably benign 0.42
X0061:Adgrf2 UTSW 17 42713074 missense probably benign 0.37
X0067:Adgrf2 UTSW 17 42710668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGTGAAATTCTTCCCAAGGC -3'
(R):5'- AATATGTGATGCAGGCAGTTTG -3'

Sequencing Primer
(F):5'- GAAATTCTTCCCAAGGCTGCCC -3'
(R):5'- TTACTCTGCAAAGAAGTTACCCGGG -3'
Posted On 2019-11-12